ALG1

ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) Antibody

20-abx111090
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) Antibody

abx036185-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) Antibody

20-abx320534
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) Antibody

20-abx321631
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) Antibody

abx230305-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

ALG1 antibody

70R-15678 50 ul
EUR 435
Description: Rabbit polyclonal ALG1 antibody

ALG1 Antibody

39590-100ul 100ul
EUR 390

ALG1 Antibody

1-CSB-PA001593GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ALG1. Recognizes ALG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ALG1 Antibody

1-CSB-PA887118ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ALG1. Recognizes ALG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ALG1 Antibody

1-CSB-PA887118ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ALG1. Recognizes ALG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ALG1 Antibody

DF12821 200ul
EUR 304
Description: ALG1 Antibody detects endogenous levels of ALG1.

ALG1 antibody

70R-7346 50 ug
EUR 467
Description: Rabbit polyclonal ALG1 antibody raised against the N terminal of ALG1

ALG1 siRNA

20-abx907275
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ALG1 siRNA

20-abx907276
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ALG1

YF-PA19949 50 ul
EUR 363
Description: Mouse polyclonal to ALG1

anti-ALG1

YF-PA19950 100 ug
EUR 403
Description: Rabbit polyclonal to ALG1

anti-ALG1

YF-PA26387 50 ul
EUR 334
Description: Mouse polyclonal to ALG1

Human ALG1, Chitobiosyldiphosphodolichol Beta-Mannosyltransferase (ALG1) ELISA Kit

abx385710-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ALG1 Polyclonal Antibody

31348-100ul 100ul
EUR 252

ALG1 Polyclonal Antibody

31348-50ul 50ul
EUR 187

ALG1 Blocking Peptide

33R-9885 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ALG1 antibody, catalog no. 70R-7346

ALG1 Blocking Peptide

DF12821-BP 1mg
EUR 195

ALG1 cloning plasmid

CSB-CL887118HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atggcggcctcatgcttggtcctgctggcgctgtgtctgctgctgccgctgctgctgctgggaggatggaagcgctggcgccgggggcgggcggcccggcatgtagtagcggtggtgctgggcgacgtgggccgcagcccccgtatgcagtaccacgcgctgtcgttggccatgc
  • Show more
Description: A cloning plasmid for the ALG1 gene.

ALG1 Rabbit pAb

A7818-100ul 100 ul
EUR 308

ALG1 Rabbit pAb

A7818-200ul 200 ul
EUR 459

ALG1 Rabbit pAb

A7818-20ul 20 ul
EUR 183

ALG1 Rabbit pAb

A7818-50ul 50 ul
EUR 223

anti- ALG1 antibody

FNab00305 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog(S. cerevisiae)
  • Uniprot ID: Q9BT22
  • Gene ID: 56052
  • Research Area: Metabolism
Description: Antibody raised against ALG1

Anti-ALG1 antibody

PAab00305 100 ug
EUR 386

Anti-ALG1 antibody

STJ110128 100 µl
EUR 277
Description: The enzyme encoded by this gene catalyzes the first mannosylation step in the biosynthesis of lipid-linked oligosaccharides. This gene is mutated in congenital disorder of glycosylation type Ik.

Human ALG1 ELISA KIT

ELI-11532h 96 Tests
EUR 824

ALG1 ELISA KIT|Human

EF007714 96 Tests
EUR 689

ALG1 Polyclonal Conjugated Antibody

C31348 100ul
EUR 397

Human ALG1 shRNA Plasmid

20-abx961042
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ALG1 shRNA Plasmid

20-abx980541
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Alg1 ELISA KIT

ELI-34572m 96 Tests
EUR 865

ALG1 Recombinant Protein (Human)

RP001015 100 ug Ask for price

ALG1 Recombinant Protein (Mouse)

RP115379 100 ug Ask for price

ALG1 Recombinant Protein (Rat)

RP189905 100 ug Ask for price

Alg1 ORF Vector (Rat) (pORF)

ORF063303 1.0 ug DNA
EUR 506

ALG1 ORF Vector (Human) (pORF)

ORF000339 1.0 ug DNA
EUR 95

Alg1 ORF Vector (Mouse) (pORF)

ORF038461 1.0 ug DNA
EUR 506

Alg1 sgRNA CRISPR Lentivector set (Rat)

K6117201 3 x 1.0 ug
EUR 339

ALG1 sgRNA CRISPR Lentivector set (Human)

K0073101 3 x 1.0 ug
EUR 339

Alg1 sgRNA CRISPR Lentivector set (Mouse)

K4025601 3 x 1.0 ug
EUR 339

Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) ELISA kit

E02C1188-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) ELISA kit

E02C1188-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) ELISA kit

E02C1188-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) ELISA kit

E06C1188-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) ELISA kit

E06C1188-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitobiosyldiphosphodolichol β mannosyltransferase(ALG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top