B4GALT3

B4GALT3 antibody

70R-15385 100 ug
EUR 327
Description: Rabbit polyclonal B4GALT3 antibody

B4GALT3 antibody

70R-15950 50 ul
EUR 435
Description: Rabbit polyclonal B4GALT3 antibody

B4GALT3 Antibody

34493-100ul 100ul
EUR 252

B4GALT3 Antibody

34493-50ul 50ul
EUR 187

B4GALT3 Antibody

1-CSB-PA002515GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

B4GALT3 Antibody

1-CSB-PA070130
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

B4GALT3 Antibody

DF3840 200ul
EUR 304
Description: B4GALT3 Antibody detects endogenous levels of total B4GALT3.

B4GALT3 antibody

70R-36904 100 ug
EUR 327
Description: Rabbit Polyclonal B4GALT3 antibody

B4GALT3 antibody

70R-50627 100 ul
EUR 244
Description: Purified Polyclonal B4GALT3 antibody

B4GALT3 antibody

70R-7307 50 ug
EUR 467
Description: Rabbit polyclonal B4GALT3 antibody raised against the N terminal of B4GALT3

B4GALT3 antibody

70R-7312 50 ug
EUR 467
Description: Rabbit polyclonal B4GALT3 antibody raised against the middle region of B4GALT3

B4GALT3 Antibody

1-CSB-PA00704A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

B4GALT3 siRNA

20-abx900574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT3 siRNA

20-abx908806
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT3 siRNA

20-abx908807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT3 Antibody

ABD3840 100 ug
EUR 438

anti-B4GALT3

YF-PA15805 50 ul
EUR 363
Description: Mouse polyclonal to B4GALT3

anti-B4GALT3

YF-PA15806 50 ug
EUR 363
Description: Mouse polyclonal to B4GALT3

anti-B4GALT3

YF-PA15807 100 ul
EUR 403
Description: Rabbit polyclonal to B4GALT3

anti-B4GALT3

YF-PA15808 100 ug
EUR 403
Description: Rabbit polyclonal to B4GALT3

B4GALT3 Rabbit pAb

A11939-100ul 100 ul
EUR 308

B4GALT3 Rabbit pAb

A11939-200ul 200 ul
EUR 459

B4GALT3 Rabbit pAb

A11939-20ul 20 ul Ask for price

B4GALT3 Rabbit pAb

A11939-50ul 50 ul
EUR 223

B4GALT3 Blocking Peptide

33R-6588 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of B4GALT3 antibody, catalog no. 70R-7312

B4GALT3 Blocking Peptide

33R-7299 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of B4GALT3 antibody, catalog no. 70R-7307

B4GALT3 antibody (HRP)

60R-1973 100 ug
EUR 327
Description: Rabbit polyclonal B4GALT3 antibody (HRP)

B4GALT3 antibody (FITC)

60R-1974 100 ug
EUR 327
Description: Rabbit polyclonal B4GALT3 antibody (FITC)

B4GALT3 antibody (biotin)

60R-1975 100 ug
EUR 327
Description: Rabbit polyclonal B4GALT3 antibody (biotin)

B4GALT3 Blocking Peptide

DF3840-BP 1mg
EUR 195

B4GALT3 Blocking Peptide

20-abx063502
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

B4GALT3 cloning plasmid

CSB-CL002515HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgttgcggaggctgctggagcggccttgcacgctggccctgcttgtgggctcccagctggctgtcatgatgtacctgtcactggggggcttccgaagtctcagtgccctatttggccgagatcagggaccgacatttgactattctcaccctcgtgatgtctacagtaacctca
  • Show more
Description: A cloning plasmid for the B4GALT3 gene.

B4GALT3 cloning plasmid

CSB-CL002515HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atgttgcggaggctgctggagcggccttgcacgctggccctgcttgtgggctcccagctggctgtcatgatgtacctgtcactggggggcttccgaagtctcagtgccctatttggccgagatcagggaccgacatttgactattctcaccctcgtgatgtctacagtaacctca
  • Show more
Description: A cloning plasmid for the B4GALT3 gene.

B4GALT3 Polyclonal Antibody

A53869 100 µg
EUR 570.55
Description: kits suitable for this type of research

B4GALT3 Rabbit pAb

A17572-100ul 100 ul
EUR 308

B4GALT3 Rabbit pAb

A17572-200ul 200 ul
EUR 459

B4GALT3 Rabbit pAb

A17572-20ul 20 ul
EUR 183

B4GALT3 Rabbit pAb

A17572-50ul 50 ul
EUR 223

anti- B4GALT3 antibody

FNab00774 100µg
EUR 548.75
  • Immunogen: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
  • Uniprot ID: O60512
  • Gene ID: 8703
  • Research Area: Metabolism
Description: Antibody raised against B4GALT3

Anti-B4GALT3 antibody

PAab00774 100 ug
EUR 386

pENTR223-B4GALT3 vector

PVT12051 2 ug
EUR 308

pExpress-B4galt3-r

PVT17627 2 ug
EUR 258

Anti-B4GALT3 antibody

STJ113859 100 µl
EUR 277
Description: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-B4GALT3 antibody

STJ119645 100 µl
EUR 277
Description: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]

B4GALT3 ELISA KIT|Human

EF008043 96 Tests
EUR 689

Rat B4GALT3 shRNA Plasmid

20-abx990798
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B4GALT3 shRNA Plasmid

20-abx974987
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

B4GALT3 Antibody, HRP conjugated

1-CSB-PA00704B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

B4GALT3 Antibody, FITC conjugated

1-CSB-PA00704C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

B4GALT3 Antibody, Biotin conjugated

1-CSB-PA00704D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALT3. Recognizes B4GALT3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Back to top