B4GALT4

B4GALT4 antibody

70R-15951 50 ul
EUR 435
Description: Rabbit polyclonal B4GALT4 antibody

B4GALT4 Antibody

45808-100ul 100ul
EUR 252

B4GALT4 Antibody

45808-50ul 50ul
EUR 187

B4GALT4 Antibody

1-CSB-PA002516GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against B4GALT4. Recognizes B4GALT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

B4GALT4 Antibody

DF9274 200ul
EUR 304
Description: B4GALT4 Antibody detects endogenous levels of total B4GALT4.

B4GALT4 siRNA

20-abx900575
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT4 siRNA

20-abx908808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT4 siRNA

20-abx908809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT4 Antibody

ABD9274 100 ug
EUR 438

anti-B4GALT4

YF-PA15801 50 ul
EUR 363
Description: Mouse polyclonal to B4GALT4

anti-B4GALT4

YF-PA15802 50 ug
EUR 363
Description: Mouse polyclonal to B4GALT4

anti-B4GALT4

YF-PA15803 100 ul
EUR 403
Description: Rabbit polyclonal to B4GALT4

anti-B4GALT4

YF-PA15804 100 ug
EUR 403
Description: Rabbit polyclonal to B4GALT4

anti-B4GALT4

YF-PA25163 50 ul
EUR 334
Description: Mouse polyclonal to B4GALT4

B4GALT4 Rabbit pAb

A14693-100ul 100 ul
EUR 308

B4GALT4 Rabbit pAb

A14693-200ul 200 ul
EUR 459

B4GALT4 Rabbit pAb

A14693-20ul 20 ul
EUR 183

B4GALT4 Rabbit pAb

A14693-50ul 50 ul
EUR 223

B4GALT4 Blocking Peptide

DF9274-BP 1mg
EUR 195

B4GALT4 Conjugated Antibody

C45808 100ul
EUR 397

B4GALT4 cloning plasmid

CSB-CL002516HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgggcttcaacctgactttccacctttcctacaaattccgattactgttgctgttgactttgtgcctgacagtggttgggtgggccaccagtaactacttcgtgggtgccattcaagagattcctaaagcaaaggagttcatggctaatttccataagaccctcattttgggga
  • Show more
Description: A cloning plasmid for the B4GALT4 gene.

B4GALT4 cloning plasmid

CSB-CL002516HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgggcttcaacctgactttccacctttcctacaaattccgattactgttgctgttgactttgtgcctgacagtggttgggtgggccaccagtaactacttcgtgggtgccattcaagagattcctaaagcaaaggagttcatggctaatttccataagaccctcattttgggga
  • Show more
Description: A cloning plasmid for the B4GALT4 gene.

B4GALT4 Rabbit pAb

A4244-100ul 100 ul
EUR 308

B4GALT4 Rabbit pAb

A4244-200ul 200 ul
EUR 459

B4GALT4 Rabbit pAb

A4244-20ul 20 ul Ask for price

B4GALT4 Rabbit pAb

A4244-50ul 50 ul Ask for price

anti- B4GALT4 antibody

FNab00775 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
  • Uniprot ID: O60513
  • Gene ID: 8702
  • Research Area: Metabolism
Description: Antibody raised against B4GALT4

Anti-B4GALT4 antibody

PAab00775 100 ug
EUR 386

Anti-B4GALT4 antibody

STJ26587 100 µl
EUR 277
Description: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene.

Anti-B4GALT4 antibody

STJ116894 100 µl
EUR 277
Description: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene.

Anti-B4GALT4 (5E2)

YF-MA16481 100 ug
EUR 363
Description: Mouse monoclonal to B4GALT4

B4GALT4 ELISA KIT|Human

EF008044 96 Tests
EUR 689

Polyclonal B4GALT4 Antibody (Center)

APR15120G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human B4GALT4 (Center). This antibody is tested and proven to work in the following applications:

Rat B4GALT4 shRNA Plasmid

20-abx989243
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B4GALT4 shRNA Plasmid

20-abx974732
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B4GALT4 shRNA Plasmid

20-abx955726
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

B4GALT4 Recombinant Protein (Human)

RP002548 100 ug Ask for price

B4GALT4 Recombinant Protein (Human)

RP002551 100 ug Ask for price

B4GALT4 Recombinant Protein (Mouse)

RP118583 100 ug Ask for price

B4GALT4 Recombinant Protein (Rat)

RP191777 100 ug Ask for price

B4galt4 ORF Vector (Rat) (pORF)

ORF063927 1.0 ug DNA
EUR 506

B4GALT4 ORF Vector (Human) (pORF)

ORF000850 1.0 ug DNA
EUR 95

B4GALT4 ORF Vector (Human) (pORF)

ORF000851 1.0 ug DNA
EUR 95

B4galt4 ORF Vector (Mouse) (pORF)

ORF039529 1.0 ug DNA
EUR 506

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

20-abx003144
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

20-abx116509
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

abx036188-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

20-abx148500
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

abx030387-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta-1,4-Galactosyltransferase 4 (B4GALT4) Antibody

abx030387-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Back to top