CCT3

CCT3 antibody

70R-16247 50 ul
EUR 435
Description: Rabbit polyclonal CCT3 antibody

CCT3 antibody

38999-100ul 100ul
EUR 252

CCT3 Antibody

1-CSB-PA004857ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CCT3. Recognizes CCT3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCT3 Antibody

1-CSB-PA004857GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCT3. Recognizes CCT3 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CCT3 Antibody

DF12113 200ul
EUR 304
Description: CCT3 antibody detects endogenous levels of CCT3.

CCT3 siRNA

20-abx900892
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT3 siRNA

20-abx910901
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT3 siRNA

20-abx910902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT3 Blocking Peptide

DF12113-BP 1mg
EUR 195

CCT3 Conjugated Antibody

C38999 100ul
EUR 397

CCT3 cloning plasmid

CSB-CL004857HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1635
  • Sequence: atgggccatcgtccagtgctcgtgctcagccagaacacaaagcgtgaatccggaagaaaagttcaatctggaaacatcaatgctgccaagactattgcagatatcatccgaacatgtttgggacccaagtccatgatgaagatgcttttggacccaatgggaggcattgtgatga
  • Show more
Description: A cloning plasmid for the CCT3 gene.

CCT3 Rabbit pAb

A6547-100ul 100 ul
EUR 308

CCT3 Rabbit pAb

A6547-200ul 200 ul
EUR 459

CCT3 Rabbit pAb

A6547-20ul 20 ul
EUR 183

CCT3 Rabbit pAb

A6547-50ul 50 ul
EUR 223

anti- CCT3 antibody

FNab01397 100µg
EUR 548.75
  • Immunogen: chaperonin containing TCP1, subunit 3(gamma)
  • Uniprot ID: P49368
  • Gene ID: 7203
  • Research Area: Metabolism
Description: Antibody raised against CCT3

anti- CCT3 antibody

FNab01398 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: chaperonin containing TCP1, subunit 3(gamma)
  • Uniprot ID: P49368
  • Gene ID: 7203
  • Research Area: Metabolism
Description: Antibody raised against CCT3

Anti-CCT3 antibody

PAab01397 100 ug
EUR 386

Anti-CCT3 Antibody

PB9926 100ug/vial
EUR 334

Anti-CCT3 antibody

STJ28630 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants have been characterized for this gene. In addition, a pseudogene of this gene has been found on chromosome 8.

CCT3 ELISA KIT|Human

EF008479 96 Tests
EUR 689

Polyclonal CCT3 Antibody (Center)

APR15320G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCT3 (Center). This antibody is tested and proven to work in the following applications:

Rat CCT3 shRNA Plasmid

20-abx988743
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCT3 shRNA Plasmid

20-abx954941
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCT3 shRNA Plasmid

20-abx969537
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCT3 Recombinant Protein (Human)

RP006250 100 ug Ask for price

CCT3 Recombinant Protein (Rat)

RP193811 100 ug Ask for price

CCT3 Recombinant Protein (Mouse)

RP122303 100 ug Ask for price

CCT3 Recombinant Protein (Mouse)

RP122306 100 ug Ask for price

Anti-CCT3 / TCP1 antibody

STJ71930 100 µg
EUR 359

Polyclonal CCT3 Antibody (C-term)

APR15319G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCT3 (C-term). This antibody is tested and proven to work in the following applications:

Cct3 ORF Vector (Rat) (pORF)

ORF064605 1.0 ug DNA
EUR 506

Anti-CCT3 Antibody (monoclonal, 12H4)

M05920 100ug/vial
EUR 294

CCT3 ORF Vector (Human) (pORF)

ORF002084 1.0 ug DNA
EUR 95

Cct3 ORF Vector (Mouse) (pORF)

ORF040769 1.0 ug DNA
EUR 506

Cct3 ORF Vector (Mouse) (pORF)

ORF040770 1.0 ug DNA
EUR 506

Polyclonal Goat Anti-CCT3 / TCP1 Antibody

APR16245G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCT3 / TCP1 . This antibody is tested and proven to work in the following applications:

CCT3 sgRNA CRISPR Lentivector set (Human)

K0396501 3 x 1.0 ug
EUR 339

Cct3 sgRNA CRISPR Lentivector set (Rat)

K7146301 3 x 1.0 ug
EUR 339

Cct3 sgRNA CRISPR Lentivector set (Mouse)

K4627601 3 x 1.0 ug
EUR 339

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

20-abx111563
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx146205-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx430056-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx231397-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Chaperonin Containing TCP1, Subunit 3 (CCT3) Antibody

abx231398-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CCT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0396502 1.0 ug DNA
EUR 154

CCT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0396503 1.0 ug DNA
EUR 154

CCT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0396504 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7146302 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7146303 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7146304 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4627602 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4627603 1.0 ug DNA
EUR 154

Cct3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4627604 1.0 ug DNA
EUR 154

CCT3 Protein Vector (Mouse) (pPB-C-His)

PV163074 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPB-N-His)

PV163075 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPM-C-HA)

PV163076 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPM-C-His)

PV163077 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPB-C-His)

PV163078 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPB-N-His)

PV163079 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPM-C-HA)

PV163080 500 ng
EUR 603

CCT3 Protein Vector (Mouse) (pPM-C-His)

PV163081 500 ng
EUR 603

CCT3 Protein Vector (Rat) (pPB-C-His)

PV258418 500 ng
EUR 603

CCT3 Protein Vector (Rat) (pPB-N-His)

PV258419 500 ng
EUR 603

CCT3 Protein Vector (Rat) (pPM-C-HA)

PV258420 500 ng
EUR 603

CCT3 Protein Vector (Rat) (pPM-C-His)

PV258421 500 ng
EUR 603

CCT3 Protein Vector (Human) (pPB-C-His)

PV008333 500 ng
EUR 329

CCT3 Protein Vector (Human) (pPB-N-His)

PV008334 500 ng
EUR 329

CCT3 Protein Vector (Human) (pPM-C-HA)

PV008335 500 ng
EUR 329

CCT3 Protein Vector (Human) (pPM-C-His)

PV008336 500 ng
EUR 329

Cct3 3'UTR GFP Stable Cell Line

TU153437 1.0 ml Ask for price

Cct3 3'UTR Luciferase Stable Cell Line

TU103437 1.0 ml Ask for price

Cct3 3'UTR Luciferase Stable Cell Line

TU201923 1.0 ml Ask for price

Cct3 3'UTR GFP Stable Cell Line

TU251923 1.0 ml Ask for price

CCT3 3'UTR GFP Stable Cell Line

TU053831 1.0 ml
EUR 1394

CCT3 3'UTR Luciferase Stable Cell Line

TU003831 1.0 ml
EUR 1394

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

20-abx005025
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

abx031772-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

abx031772-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

abx031773-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

abx031773-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

20-abx322243
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Gamma (CCT3) Antibody

20-abx225084
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCT3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV689653 1.0 ug DNA
EUR 682

CCT3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV689657 1.0 ug DNA
EUR 682

CCT3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV689658 1.0 ug DNA
EUR 682

Porcine T- complex protein 1 subunit gamma, CCT3 ELISA KIT

ELI-18862p 96 Tests
EUR 928

Bovine T- complex protein 1 subunit gamma, CCT3 ELISA KIT

ELI-29162b 96 Tests
EUR 928

Mouse T- complex protein 1 subunit gamma, Cct3 ELISA KIT

ELI-29163m 96 Tests
EUR 865

Human T- complex protein 1 subunit gamma, CCT3 ELISA KIT

ELI-52103h 96 Tests
EUR 824

Back to top