cd1c

CD1C Antibody

1-CSB-PA004891ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CD1C Antibody

1-CSB-PA004891LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

CD1C Antibody

1-CSB-PA005190
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD1c Antibody

abx140460-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

CD1C siRNA

20-abx910944
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CD1c

YF-PA23382 50 ul
EUR 334
Description: Mouse polyclonal to CD1c

Human T-cell surface glycoprotein CD1c (CD1C)

1-CSB-EP004891HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-cell surface glycoprotein CD1c(CD1C),partial expressed in E.coli

Human T-cell surface glycoprotein CD1c (CD1C)

1-CSB-YP004891HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-cell surface glycoprotein CD1c(CD1C),partial expressed in Yeast

T-cell Surface Glycoprotein CD1c (CD1C) Antibody

abx146198-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody

abx139086-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody

20-abx323645
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody

20-abx318090
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody

20-abx322035
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody (PE)

abx139087-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody (HRP)

20-abx316803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody (FITC)

20-abx316804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-cell Surface Glycoprotein CD1c (CD1C) Antibody (Biotin)

20-abx316805
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD1c antibody (FITC)

61R-1029 100 tests
EUR 386
Description: Mouse monoclonal CD1c antibody (FITC)

CD1C Polyclonal Antibody

41646-100ul 100ul
EUR 252

CD1C Polyclonal Antibody

41646-50ul 50ul
EUR 187

Anti-CD1c Antibody

A01188-1 100ug/vial
EUR 294

CD1C cloning plasmid

CSB-CL004891HU1-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgctgtttctgcagtttctgctgctagctcttcttctcccaggtggtgacaatgcagacgcatcccaggaacacgtctccttccatgtcatccagatcttctcatttgtcaaccaatcctgggcacgaggtcagggctcaggatggctggatgagttgcagactcatggctggg
  • Show more
Description: A cloning plasmid for the CD1C gene.

CD1C cloning plasmid

CSB-CL004891HU2-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgctgtttctgcagtttctgctgctagctcttcttctcccaggtggtgacaatgcagacgcatcccaggaacacgtctccttccatgtcatccagatcttctcatttgtcaaccaatcctgggcacgaggtcagggctcaggatggctggacgagttgcagactcatggctggg
  • Show more
Description: A cloning plasmid for the CD1C gene.

CD1C Polyclonal Antibody

ABP52969-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD1C
  • Applications tips:
Description: A polyclonal antibody for detection of CD1C from Human. This CD1C antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD1C

CD1C Polyclonal Antibody

ABP52969-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD1C
  • Applications tips:
Description: A polyclonal antibody for detection of CD1C from Human. This CD1C antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD1C

CD1C Polyclonal Antibody

ABP52969-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD1C
  • Applications tips:
Description: A polyclonal antibody for detection of CD1C from Human. This CD1C antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD1C

CD1C Polyclonal Antibody

ES3968-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD1C from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD1C Polyclonal Antibody

ES3968-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD1C from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-CD1C antibody

STJ96603 200 µl
EUR 197
Description: Rabbit polyclonal to CD1C.

Anti-CD1c (4B11)

YF-MA12307 100 ug
EUR 363
Description: Mouse monoclonal to CD1c

Human T-cell surface glycoprotein CD1c(CD1C) ELISA kit

CSB-EL004891HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-cell surface glycoprotein CD1c (CD1C) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-cell surface glycoprotein CD1c(CD1C) ELISA kit

1-CSB-EL004891HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-cell surface glycoprotein CD1c(CD1C) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human T- cell surface glycoprotein CD1c, CD1C ELISA KIT

ELI-49936h 96 Tests
EUR 824

Anti-Hu CD1c Purified

11-752-C025 0.025 mg
EUR 99

Anti-Hu CD1c Purified

11-752-C100 0.1 mg
EUR 158

Anti-Hu CD1c APC

1A-752-T100 100 tests
EUR 240

Anti-Hu CD1c PE

1P-752-T025 25 tests
EUR 140

Anti-Hu CD1c PE

1P-752-T100 100 tests
EUR 240

CD1C Antibody, HRP conjugated

1-CSB-PA004891LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD1C Antibody, FITC conjugated

1-CSB-PA004891LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD1C Antibody, Biotin conjugated

1-CSB-PA004891LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD1C. Recognizes CD1C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CD1C shRNA Plasmid

20-abx950640
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD1c Recombinant Protein (Human)

RP037888 100 ug Ask for price

CD1c Recombinant Protein (Human)

RP037891 100 ug Ask for price

Anti-CD1C/Bdca 1 Antibody

A01188 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD1C Antibody (CD1C) detection. Tested with WB in Human.

CD1C ORF Vector (Human) (pORF)

ORF012630 1.0 ug DNA
EUR 354

CD1C ORF Vector (Human) (pORF)

ORF012631 1.0 ug DNA
EUR 354

Mouse Anti Human Cd1c Monoclonal Antibody

CABT-48622MH 0.2 mg
EUR 741

Mouse Anti-Human CD1C Monoclonal Antibody

CABT-24705MH 100ug
EUR 663

CD1C sgRNA CRISPR Lentivector set (Human)

K0398901 3 x 1.0 ug
EUR 339

Monoclonal CD1C Antibody (clone 4C7), Clone: 4C7

AMM02288G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human CD1C (clone 4C7). The antibodies are raised in Mouse and are from clone 4C7. This antibody is applicable in WB and IHC-P, IF

CD1C sgRNA CRISPR Lentivector (Human) (Target 1)

K0398902 1.0 ug DNA
EUR 154

CD1C sgRNA CRISPR Lentivector (Human) (Target 2)

K0398903 1.0 ug DNA
EUR 154

CD1C sgRNA CRISPR Lentivector (Human) (Target 3)

K0398904 1.0 ug DNA
EUR 154

CD1c Protein Vector (Human) (pPB-C-His)

PV050517 500 ng
EUR 481

CD1c Protein Vector (Human) (pPB-N-His)

PV050518 500 ng
EUR 481

CD1c Protein Vector (Human) (pPM-C-HA)

PV050519 500 ng
EUR 481

CD1c Protein Vector (Human) (pPM-C-His)

PV050520 500 ng
EUR 481

CD1c Protein Vector (Human) (pPB-C-His)

PV050521 500 ng
EUR 481

CD1c Protein Vector (Human) (pPB-N-His)

PV050522 500 ng
EUR 481

CD1c Protein Vector (Human) (pPM-C-HA)

PV050523 500 ng
EUR 481

CD1c Protein Vector (Human) (pPM-C-His)

PV050524 500 ng
EUR 481

CD1C 3'UTR GFP Stable Cell Line

TU053856 1.0 ml
EUR 1394

CD1C 3'UTR Luciferase Stable Cell Line

TU003856 1.0 ml
EUR 1394

CD1c Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV706659 1.0 ug DNA
EUR 450

CD1c Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV706663 1.0 ug DNA
EUR 450

CD1c Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV706664 1.0 ug DNA
EUR 450

CD1C sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0398905 3 x 1.0 ug
EUR 376

CD1c Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV706660 1.0 ug DNA
EUR 450

CD1c Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV706661 1.0 ug DNA
EUR 508

CD1c Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV706662 1.0 ug DNA
EUR 508

CD1C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0398906 1.0 ug DNA
EUR 167

CD1C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0398907 1.0 ug DNA
EUR 167

CD1C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0398908 1.0 ug DNA
EUR 167

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-100ug

QP5783-ec-100ug 100ug
EUR 571

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-10ug

QP5783-ec-10ug 10ug
EUR 272

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-1mg

QP5783-ec-1mg 1mg
EUR 2303

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-200ug

QP5783-ec-200ug 200ug
EUR 898

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-500ug

QP5783-ec-500ug 500ug
EUR 1514

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, E.coli-50ug

QP5783-ec-50ug 50ug
EUR 362

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-100ug

QP5783-ye-100ug 100ug
EUR 670

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-10ug

QP5783-ye-10ug 10ug
EUR 308

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-1mg

QP5783-ye-1mg 1mg
EUR 2747

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-200ug

QP5783-ye-200ug 200ug
EUR 1069

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-500ug

QP5783-ye-500ug 500ug
EUR 1804

Recombinant Human T-cell surface glycoprotein CD1c Protein, His, Yeast-50ug

QP5783-ye-50ug 50ug
EUR 417

Back to top