CDC73

CDC73 antibody

70R-16312 50 ul
EUR 435
Description: Rabbit polyclonal CDC73 antibody

CDC73 Antibody

1-CSB-PA005024GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC73. Recognizes CDC73 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CDC73 Antibody

1-CSB-PA750783LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC73. Recognizes CDC73 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CDC73 siRNA

20-abx900945
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC73 siRNA

20-abx911170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC73 siRNA

20-abx911171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC73 Rabbit pAb

A0636-100ul 100 ul
EUR 308

CDC73 Rabbit pAb

A0636-200ul 200 ul
EUR 459

CDC73 Rabbit pAb

A0636-20ul 20 ul Ask for price

CDC73 Rabbit pAb

A0636-50ul 50 ul Ask for price

CDC73 cloning plasmid

CSB-CL750783HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgtcagtggaaaaaattgctgcaatcaaagccaaaattatggctaagaaaagatctactatcaagactgatctagatgatgacataactgcccttaaacagaggagttttgtggatgctgaggtagatgtgacccgagatattgtcagcagagagagagtatggaggacacgaa
  • Show more
Description: A cloning plasmid for the CDC73 gene.

CDC73 cloning plasmid

CSB-CL750783HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1596
  • Sequence: atggcggacgtgcttagcgtcctgcgacagtacaacatccagaagaaggagattgtggtgaagggagacgaagtgatcttcggggagttctcctggcccaagaatgtgaagaccaactatgttgtttgggggactggaaaggaaggccaacccagagagtactacacattggatt
  • Show more
Description: A cloning plasmid for the CDC73 gene.

Anti-CDC73 antibody

STJ23034 100 µl
EUR 277
Description: This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma.

CDC73 Antibody, HRP conjugated

1-CSB-PA750783LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC73. Recognizes CDC73 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDC73 Antibody, FITC conjugated

1-CSB-PA750783LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC73. Recognizes CDC73 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDC73 Antibody, Biotin conjugated

1-CSB-PA750783LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC73. Recognizes CDC73 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat CDC73 shRNA Plasmid

20-abx989294
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CDC73 shRNA Plasmid

20-abx980868
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CDC73 shRNA Plasmid

20-abx962403
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-HRPT2/CDC73 Antibody

PB9532 100ug/vial
EUR 294

CDC73 Recombinant Protein (Human)

RP006535 100 ug Ask for price

CDC73 Recombinant Protein (Human)

RP006538 100 ug Ask for price

CDC73 Recombinant Protein (Rat)

RP194171 100 ug Ask for price

CDC73 Recombinant Protein (Mouse)

RP122906 100 ug Ask for price

Human Parafibromin (CDC73) ELISA Kit

abx259628-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Parafibromin, CDC73 ELISA KIT

ELI-25767c 96 Tests
EUR 928

Mouse Parafibromin, Cdc73 ELISA KIT

ELI-34178m 96 Tests
EUR 865

Human Parafibromin, CDC73 ELISA KIT

ELI-50294h 96 Tests
EUR 824

Cdc73 ORF Vector (Rat) (pORF)

ORF064725 1.0 ug DNA
EUR 506

CDC73 ORF Vector (Human) (pORF)

ORF002179 1.0 ug DNA
EUR 95

CDC73 ORF Vector (Human) (pORF)

ORF002180 1.0 ug DNA
EUR 95

Cdc73 ORF Vector (Mouse) (pORF)

ORF040970 1.0 ug DNA
EUR 506

Cell Division Cycle 73 (CDC73) Antibody

20-abx111534
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody

abx034262-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody

abx034262-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody

20-abx313487
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody

20-abx000790
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Cdc73 sgRNA CRISPR Lentivector set (Mouse)

K4895901 3 x 1.0 ug
EUR 339

CDC73 sgRNA CRISPR Lentivector set (Human)

K0413201 3 x 1.0 ug
EUR 339

ELISA kit for Human Parafibromin (CDC73)

KTE62197-48T 48T
EUR 332
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Parafibromin (CDC73)

KTE62197-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Parafibromin (CDC73)

KTE62197-96T 96T
EUR 539
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cdc73 sgRNA CRISPR Lentivector set (Rat)

K6738201 3 x 1.0 ug
EUR 339

Cdc73 sgRNA CRISPR Lentivector set (Mouse)

K3001101 3 x 1.0 ug
EUR 339

ELISA kit for Rat Parafibromin (CDC73)

KTE100820-48T 48T
EUR 332
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Parafibromin (CDC73)

KTE100820-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Parafibromin (CDC73)

KTE100820-96T 96T
EUR 539
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parafibromin (CDC73)

KTE71371-48T 48T
EUR 332
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parafibromin (CDC73)

KTE71371-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parafibromin (CDC73)

KTE71371-96T 96T
EUR 539
  • CDC73 encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone m
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Parafibromin (CDC73)

KTE30148-48T 48T
EUR 354
  • Parafibromin (CDC73) is a tumor suppressor probably involved in transcriptional and post-transcriptional control pathways. May be involved in cell cycle progression through the regulation of cyclin D1/PRAD1 expression. Component of the PAF1 complex (
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Parafibromin (CDC73)

KTE30148-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Parafibromin (CDC73) is a tumor suppressor probably involved in transcriptional and post-transcriptional control pathways. May be involved in cell cycle progression through the regulation of cyclin D1/PRAD1 expression. Component of the PAF1 complex (
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Parafibromin (CDC73)

KTE30148-96T 96T
EUR 572
  • Parafibromin (CDC73) is a tumor suppressor probably involved in transcriptional and post-transcriptional control pathways. May be involved in cell cycle progression through the regulation of cyclin D1/PRAD1 expression. Component of the PAF1 complex (
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Parafibromin (CDC73) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cell Division Cycle 73 (CDC73) Antibody (HRP)

20-abx313488
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody (FITC)

20-abx313489
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cell Division Cycle 73 (CDC73) Antibody (Biotin)

20-abx313490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4895902 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4895903 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4895904 1.0 ug DNA
EUR 154

CDC73 sgRNA CRISPR Lentivector (Human) (Target 1)

K0413202 1.0 ug DNA
EUR 154

CDC73 sgRNA CRISPR Lentivector (Human) (Target 2)

K0413203 1.0 ug DNA
EUR 154

CDC73 sgRNA CRISPR Lentivector (Human) (Target 3)

K0413204 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6738202 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6738203 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6738204 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3001102 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3001103 1.0 ug DNA
EUR 154

Cdc73 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3001104 1.0 ug DNA
EUR 154

CDC73 Protein Vector (Mouse) (pPB-C-His)

PV163878 500 ng
EUR 603

CDC73 Protein Vector (Mouse) (pPB-N-His)

PV163879 500 ng
EUR 603

CDC73 Protein Vector (Mouse) (pPM-C-HA)

PV163880 500 ng
EUR 603

CDC73 Protein Vector (Mouse) (pPM-C-His)

PV163881 500 ng
EUR 603

CDC73 Protein Vector (Rat) (pPB-C-His)

PV258898 500 ng
EUR 603

CDC73 Protein Vector (Rat) (pPB-N-His)

PV258899 500 ng
EUR 603

CDC73 Protein Vector (Rat) (pPM-C-HA)

PV258900 500 ng
EUR 603

CDC73 Protein Vector (Rat) (pPM-C-His)

PV258901 500 ng
EUR 603

CDC73 Protein Vector (Human) (pPB-C-His)

PV008713 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPB-N-His)

PV008714 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPM-C-HA)

PV008715 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPM-C-His)

PV008716 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPB-C-His)

PV008717 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPB-N-His)

PV008718 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPM-C-HA)

PV008719 500 ng
EUR 329

CDC73 Protein Vector (Human) (pPM-C-His)

PV008720 500 ng
EUR 329

Cdc73 3'UTR GFP Stable Cell Line

TU153577 1.0 ml Ask for price

Cdc73 3'UTR Luciferase Stable Cell Line

TU103577 1.0 ml Ask for price

Cdc73 3'UTR Luciferase Stable Cell Line

TU202050 1.0 ml Ask for price

Cdc73 3'UTR GFP Stable Cell Line

TU252050 1.0 ml Ask for price

CDC73 3'UTR GFP Stable Cell Line

TU053999 1.0 ml
EUR 2333

CDC73 3'UTR Luciferase Stable Cell Line

TU003999 1.0 ml
EUR 2333

Back to top