CPB2

CPB2 Antibody

DF3897 200ul
EUR 304
Description: CPB2 Antibody detects endogenous levels of total CPB2.

CPB2 antibody

70R-37054 100 ug
EUR 327
Description: Rabbit Polyclonal CPB2 antibody

CPB2 Antibody

1-CSB-PA007212
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CPB2. Recognizes CPB2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

CPB2 siRNA

20-abx901221
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPB2 siRNA

20-abx912646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPB2 siRNA

20-abx912647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CPB2 Antibody

ABD3897 100 ug
EUR 438

CPB2 Polyclonal Antibody

30658-100ul 100ul
EUR 252

CPB2 Polyclonal Antibody

30658-50ul 50ul
EUR 187

CPB2 Polyclonal Antibody

28893-100ul 100ul
EUR 252

CPB2 Polyclonal Antibody

28893-50ul 50ul
EUR 187

CPB2 Polyclonal Antibody

28311-100ul 100ul
EUR 252

CPB2 Polyclonal Antibody

28311-50ul 50ul
EUR 187

CPB2 Rabbit pAb

A15266-100ul 100 ul
EUR 308

CPB2 Rabbit pAb

A15266-200ul 200 ul
EUR 459

CPB2 Rabbit pAb

A15266-20ul 20 ul
EUR 183

CPB2 Rabbit pAb

A15266-50ul 50 ul
EUR 223

CPB2 Rabbit pAb

A13661-100ul 100 ul
EUR 308

CPB2 Rabbit pAb

A13661-200ul 200 ul
EUR 459

CPB2 Rabbit pAb

A13661-20ul 20 ul
EUR 183

CPB2 Rabbit pAb

A13661-50ul 50 ul
EUR 223

CPB2 Blocking Peptide

DF3897-BP 1mg
EUR 195

CPB2 cloning plasmid

CSB-CL853435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atgaagctttgcagccttgcagtccttgtacccattgttctcttctgtgagcagcatgtcttcgcgtttcagagtggccaagttctagctgctcttcctagaacctctaggcaagttcaagttctacagaatcttactacaacatatgagattgttctctggcagccggtaacag
  • Show more
Description: A cloning plasmid for the CPB2 gene.

CPB2 Rabbit pAb

A5634-100ul 100 ul
EUR 308

CPB2 Rabbit pAb

A5634-200ul 200 ul
EUR 459

CPB2 Rabbit pAb

A5634-20ul 20 ul
EUR 183

CPB2 Rabbit pAb

A5634-50ul 50 ul
EUR 223

Anti-CPB2 antibody

STJ27601 100 µl
EUR 277
Description: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants.

Anti-CPB2 antibody

STJ115617 100 µl
EUR 277
Description: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants.

Anti-CPB2 antibody

STJ117461 100 µl
EUR 277
Description: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants.

CPB2 Antibody, HRP conjugated

1-CSB-PA005884LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPB2. Recognizes CPB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CPB2 Antibody, FITC conjugated

1-CSB-PA005884LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPB2. Recognizes CPB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CPB2 Antibody, Biotin conjugated

1-CSB-PA005884LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPB2. Recognizes CPB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CPB2 ELISA Kit

ELA-E0615h 96 Tests
EUR 824

CPB2 ELISA KIT|Human

EF000673 96 Tests
EUR 689

Mouse CPB2 shRNA Plasmid

20-abx974730
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CPB2 shRNA Plasmid

20-abx987124
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPB2 Polyclonal Conjugated Antibody

C28311 100ul
EUR 397

CPB2 Polyclonal Conjugated Antibody

C28893 100ul
EUR 397

CPB2 Polyclonal Conjugated Antibody

C30658 100ul
EUR 397

Carboxypeptidase B2 (CPB2) Antibody

20-abx323881
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human CPB2 shRNA Plasmid

20-abx950951
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CPB2 Recombinant Protein (Human)

RP007846 100 ug Ask for price

CPB2 Recombinant Protein (Rat)

RP196079 100 ug Ask for price

CPB2 Recombinant Protein (Mouse)

RP125711 100 ug Ask for price

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx006788
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx104308
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx104309
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx104310
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx104311
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx104312
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx119590
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

abx145279-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

abx148902-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

20-abx318268
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carboxypeptidase B2 / TAFI (CPB2) Antibody

abx231265-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cpb2 ORF Vector (Rat) (pORF)

ORF065361 1.0 ug DNA
EUR 506

CPB2 ORF Vector (Human) (pORF)

ORF002616 1.0 ug DNA
EUR 95

Cpb2 ORF Vector (Mouse) (pORF)

ORF041905 1.0 ug DNA
EUR 506

Anti-Carboxypeptidase B2/CPB2 Antibody

PB9997 100ug/vial
EUR 334

Anti-Carboxypeptidase B2/CPB2 Antibody

PB9998 100ug/vial
EUR 294

pECMV-Cpb2-m-FLAG Plasmid

PVT15165 2 ug
EUR 325

CPB2 ELISA Kit (Human) (OKAN05715)

OKAN05715 96 Wells
EUR 792
Description: Description of target: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.137 ng/mL

CPB2 ELISA Kit (Rat) (OKCD02899)

OKCD02899 96 Wells
EUR 818
Description: Description of target: Cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. Down-regulates fibrinolysis by removing C-terminal lysine residues from fibrin that has already been partially degraded by plasmin.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33 ng/mL

CPB2 ELISA Kit (Mouse) (OKCD02916)

OKCD02916 96 Wells
EUR 779
Description: Description of target: Cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. Down-regulates fibrinolysis by removing C-terminal lysine residues from fibrin that has already been partially degraded by plasmin. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.128 ng/mL

CPB2 ELISA Kit (Human) (OKBB01032)

OKBB01032 96 Wells
EUR 505
Description: Description of target: Carboxypeptidase B2 (CPB2), also known as carboxypeptidase U (CPU), plasma carboxypeptidase B (pCPB) or thrombin-activatable fibrinolysis inhibitor (TAFI), is an enzyme that, in humans, is encoded by the gene CPB2. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin/thrombomodulin complex, CPB2 exhibits carboxypeptidase activity. Activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

CPB2 ELISA Kit (Human) (OKCD06584)

OKCD06584 96 Wells
EUR 753
Description: Description of target: Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Available sequence data analyses indicate splice variants that encode different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.133ng/mL

Mouse Cpb2/ Carboxypeptidase B2 ELISA Kit

E0315Mo 1 Kit
EUR 571

Human CPB2/ Carboxypeptidase B2 ELISA Kit

E0545Hu 1 Kit
EUR 571

Human Carboxypeptidase B2 (CPB2) ELISA Kit

abx054753-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Back to top