CTSD

Bovine Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-b-96T 96T
EUR 746
  • Should the Bovine Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Bovine Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Hu-48T 48T
EUR 498
  • Should the Human Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Hu-96T 96T
EUR 647
  • Should the Human Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Mu-48T 48T
EUR 508
  • Should the Mouse Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Mu-96T 96T
EUR 661
  • Should the Mouse Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Ra-48T 48T
EUR 528
  • Should the Rat Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cathepsin D (CTSD) ELISA Kit

DLR-CTSD-Ra-96T 96T
EUR 690
  • Should the Rat Cathepsin D (CTSD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cathepsin D (CTSD) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-b-48Tests 48 Tests
EUR 607

Bovine Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-b-96Tests 96 Tests
EUR 845

Human Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Hu-48Tests 48 Tests
EUR 522

Human Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Hu-96Tests 96 Tests
EUR 724

Mouse Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Mu-48Tests 48 Tests
EUR 534

Mouse Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Mu-96Tests 96 Tests
EUR 742

Rat Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Ra-48Tests 48 Tests
EUR 558

Rat Cathepsin D (CTSD) ELISA Kit

RDR-CTSD-Ra-96Tests 96 Tests
EUR 776

Bovine Cathepsin D (CTSD) ELISA Kit

RD-CTSD-b-48Tests 48 Tests
EUR 580

Bovine Cathepsin D (CTSD) ELISA Kit

RD-CTSD-b-96Tests 96 Tests
EUR 807

Human Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Hu-48Tests 48 Tests
EUR 500

Human Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Hu-96Tests 96 Tests
EUR 692

Mouse Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Mu-48Tests 48 Tests
EUR 511

Mouse Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Mu-96Tests 96 Tests
EUR 709

Rat Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Ra-48Tests 48 Tests
EUR 534

Rat Cathepsin D (CTSD) ELISA Kit

RD-CTSD-Ra-96Tests 96 Tests
EUR 742

Ctsd/ Rat Ctsd ELISA Kit

ELI-04236r 96 Tests
EUR 886

CTSD protein

30R-3256 50 ug
EUR 257
Description: Purified recombinant CTSD protein

CTSD protein

30R-3257 50 ug
EUR 257
Description: Purified recombinant CTSD protein

CTSD antibody

70R-16660 50 ul
EUR 435
Description: Rabbit polyclonal CTSD antibody

CTSD Antibody

35320-100ul 100ul
EUR 252

CTSD Antibody

35320-50ul 50ul
EUR 187

CTSD Antibody

32331-100ul 100ul
EUR 252

CTSD Antibody

1-CSB-PA006187GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CTSD Antibody

1-CSB-PA001329
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CTSD Antibody

CSB-PA145976-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CTSD Antibody

CSB-PA145976-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CTSD Antibody

DF4824 200ul
EUR 304
Description: CTSD Antibody detects endogenous levels of total CTSD.

CTSD Antibody

DF6486 200ul
EUR 304
Description: CTSD Antibody detects endogenous levels of total CTSD.

Ctsd antibody

70R-8506 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Ctsd antibody

CTSD Antibody

1-CSB-PA02129A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IP; Recommended dilution: IP:1:200-1:2000

CTSD Antibody

1-CSB-PA007428
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CTSD Antibody

1-CSB-PA007429
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CTSD. Recognizes CTSD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

CTSD siRNA

20-abx913138
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTSD siRNA

20-abx913139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTSD Antibody

ABD4824 100 ug
EUR 438

CTSD Antibody

ABD6486 100 ug
EUR 438

pCMV- CTSD

PVT10245 2 ug
EUR 301

CTSD Rabbit pAb

A1594-100ul 100 ul
EUR 308

CTSD Rabbit pAb

A1594-200ul 200 ul
EUR 459

CTSD Rabbit pAb

A1594-20ul 20 ul
EUR 183

CTSD Rabbit pAb

A1594-50ul 50 ul
EUR 223

CTSD Rabbit pAb

A13292-100ul 100 ul
EUR 308

CTSD Rabbit pAb

A13292-200ul 200 ul
EUR 459

CTSD Rabbit pAb

A13292-20ul 20 ul
EUR 183

CTSD Rabbit pAb

A13292-50ul 50 ul
EUR 223

Ctsd Blocking Peptide

33R-4678 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ctsd antibody, catalog no. 70R-8506

Polyclonal CTSD Antibody

APR04657G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CTSD . This antibody is tested and proven to work in the following applications:

CTSD Blocking Peptide

DF4824-BP 1mg
EUR 195

CTSD Blocking Peptide

DF6486-BP 1mg
EUR 195

CTSD Rabbit pAb

A0041-100ul 100 ul
EUR 308

CTSD Rabbit pAb

A0041-200ul 200 ul
EUR 459

CTSD Rabbit pAb

A0041-20ul 20 ul Ask for price

CTSD Rabbit pAb

A0041-50ul 50 ul Ask for price

CTSD Conjugated Antibody

C32331 100ul
EUR 397

CTSD cloning plasmid

CSB-CL006187HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1239
  • Sequence: atgcagccctccagccttctgccgctcgccctctgcctgctggctgcacccgcctccgcgctcgtcaggatcccgctgcacaagttcacgtccatccgccggaccatgtcggaggttgggggctctgtggaggacctgattgccaaaggccccgtctcaaagtactcccaggcgg
  • Show more
Description: A cloning plasmid for the CTSD gene.

CTSD Polyclonal Antibody

A52324 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-CTSD antibody

STJ110893 100 µl
EUR 277
Description: This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease.

Anti-CTSD antibody

STJ115256 100 µl
EUR 277
Description: This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease.

Anti-CTSD antibody

STJ23280 100 µl
EUR 277
Description: This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease.

Human Cathepsin D (CTSD)

1-CSB-EP006187HU1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cathepsin D(CTSD),partial expressed in E.coli

Human Cathepsin D (CTSD)

1-CSB-EP006187HU1e0
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cathepsin D(CTSD),partial expressed in E.coli

Cleaved-CTSD (L169) Antibody

1-CSB-PA000030
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-CTSD (L169). Recognizes Cleaved-CTSD (L169) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Back to top