DOLPP1

DOLPP1 siRNA

20-abx914511
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOLPP1 siRNA

20-abx914512
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DOLPP1 Blocking Peptide

33R-1013 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED14 antibody, catalog no. 70R-9589

DOLPP1 cloning plasmid

CSB-CL801265HU-10ug 10ug
EUR 192
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 294
  • Sequence: atgccctccagccattcccagtttatgtggttcttctccgtctattccttccttttcctgtatttaagaatgcaccaaacaaacaacgccaggttcctggacttgctgtggaggcacgtgctctccctgggactcctcgctgtggccttcctagtctcctacagcaggcctgtctc
  • Show more
Description: A cloning plasmid for the DOLPP1 gene.

Dolichyldiphosphatase 1 (DOLPP1) Antibody

abx027522-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyldiphosphatase 1 (DOLPP1) Antibody

abx027522-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DOLPP1 ELISA KIT|Human

EF004873 96 Tests
EUR 689

Mouse DOLPP1 shRNA Plasmid

20-abx974939
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DOLPP1 shRNA Plasmid

20-abx961373
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DOLPP1 Recombinant Protein (Human)

RP009715 100 ug Ask for price

DOLPP1 Recombinant Protein (Rat)

RP198518 100 ug Ask for price

DOLPP1 Recombinant Protein (Mouse)

RP129851 100 ug Ask for price

Dolpp1 ORF Vector (Rat) (pORF)

ORF066174 1.0 ug DNA
EUR 506

DOLPP1 ORF Vector (Human) (pORF)

ORF003239 1.0 ug DNA
EUR 95

Dolpp1 ORF Vector (Mouse) (pORF)

ORF043285 1.0 ug DNA
EUR 506

Mouse Dolichyldiphosphatase 1, Dolpp1 ELISA KIT

ELI-28062m 96 Tests
EUR 865

Human Dolichyldiphosphatase 1 (DOLPP1) ELISA Kit

abx384808-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dolichyldiphosphatase 1 (DOLPP1) ELISA Kit

abx389099-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dolichyldiphosphatase 1, DOLPP1 ELISA KIT

ELI-47639h 96 Tests
EUR 824

DOLPP1 sgRNA CRISPR Lentivector set (Human)

K0625701 3 x 1.0 ug
EUR 339

Dolpp1 sgRNA CRISPR Lentivector set (Rat)

K6379701 3 x 1.0 ug
EUR 339

Dolpp1 sgRNA CRISPR Lentivector set (Mouse)

K3056701 3 x 1.0 ug
EUR 339

DOLPP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0625702 1.0 ug DNA
EUR 154

DOLPP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0625703 1.0 ug DNA
EUR 154

DOLPP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0625704 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6379702 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6379703 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6379704 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3056702 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3056703 1.0 ug DNA
EUR 154

Dolpp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3056704 1.0 ug DNA
EUR 154

DOLPP1 Protein Vector (Mouse) (pPB-C-His)

PV173138 500 ng
EUR 603

DOLPP1 Protein Vector (Mouse) (pPB-N-His)

PV173139 500 ng
EUR 603

DOLPP1 Protein Vector (Mouse) (pPM-C-HA)

PV173140 500 ng
EUR 603

DOLPP1 Protein Vector (Mouse) (pPM-C-His)

PV173141 500 ng
EUR 603

DOLPP1 Protein Vector (Rat) (pPB-C-His)

PV264694 500 ng
EUR 603

DOLPP1 Protein Vector (Rat) (pPB-N-His)

PV264695 500 ng
EUR 603

DOLPP1 Protein Vector (Rat) (pPM-C-HA)

PV264696 500 ng
EUR 603

DOLPP1 Protein Vector (Rat) (pPM-C-His)

PV264697 500 ng
EUR 603

DOLPP1 Protein Vector (Human) (pPB-C-His)

PV012953 500 ng
EUR 329

DOLPP1 Protein Vector (Human) (pPB-N-His)

PV012954 500 ng
EUR 329

DOLPP1 Protein Vector (Human) (pPM-C-HA)

PV012955 500 ng
EUR 329

DOLPP1 Protein Vector (Human) (pPM-C-His)

PV012956 500 ng
EUR 329

Dolpp1 3'UTR GFP Stable Cell Line

TU155335 1.0 ml Ask for price

Dolpp1 3'UTR Luciferase Stable Cell Line

TU105335 1.0 ml Ask for price

Dolpp1 3'UTR Luciferase Stable Cell Line

TU203584 1.0 ml Ask for price

Dolpp1 3'UTR GFP Stable Cell Line

TU253584 1.0 ml Ask for price

DOLPP1 3'UTR GFP Stable Cell Line

TU056252 1.0 ml
EUR 1521

DOLPP1 3'UTR Luciferase Stable Cell Line

TU006252 1.0 ml
EUR 1521

Dolpp1 ELISA Kit| Mouse Dolichyldiphosphatase 1 ELISA Kit

EF014729 96 Tests
EUR 689

DOLPP1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0625705 3 x 1.0 ug
EUR 376

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6379705 3 x 1.0 ug
EUR 376

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3056705 3 x 1.0 ug
EUR 376

DOLPP1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0625706 1.0 ug DNA
EUR 167

DOLPP1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0625707 1.0 ug DNA
EUR 167

DOLPP1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0625708 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6379706 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6379707 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6379708 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3056706 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3056707 1.0 ug DNA
EUR 167

Dolpp1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3056708 1.0 ug DNA
EUR 167

Back to top