EIF3H antibody

70R-17050 50 ul
EUR 435
Description: Rabbit polyclonal EIF3H antibody

EIF3H Antibody

36437-100ul 100ul
EUR 252

EIF3H Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EIF3H Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

EIF3H antibody

70R-8910 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EIF3H antibody

EIF3H antibody

70R-8911 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EIF3H antibody

EIF3H Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EIF3H Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

EIF3H Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF3H. Recognizes EIF3H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3H Rabbit pAb

A13378-100ul 100 ul
EUR 308

EIF3H Rabbit pAb

A13378-200ul 200 ul
EUR 459

EIF3H Rabbit pAb

A13378-20ul 20 ul
EUR 183

EIF3H Rabbit pAb

A13378-50ul 50 ul
EUR 223

EIF3H Blocking Peptide

33R-5201 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3H antibody, catalog no. 70R-8911

EIF3H Blocking Peptide

33R-5760 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3H antibody, catalog no. 70R-8910

EIF3H Conjugated Antibody

C36437 100ul
EUR 397

EIF3H cloning plasmid

CSB-CL007537HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggcgtcccgcaaggaaggtaccggctctactgccacctcttccagctccaccgccggcgcagcagggaaaggcaaaggcaaaggcggctcgggagattcagccgtgaagcaagtgcagatagatggccttgtggtattaaagataatcaaacattatcaagaagaaggacaag
  • Show more
Description: A cloning plasmid for the EIF3H gene.

EIF3H Rabbit pAb

A7024-100ul 100 ul
EUR 308

EIF3H Rabbit pAb

A7024-200ul 200 ul
EUR 459

EIF3H Rabbit pAb

A7024-20ul 20 ul
EUR 183

EIF3H Rabbit pAb

A7024-50ul 50 ul
EUR 223

anti- EIF3H antibody

FNab02709 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • IP: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 3, subunit H
  • Uniprot ID: O15372
  • Gene ID: 8667
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against EIF3H

Anti-EIF3H antibody

PAab02709 100 ug
EUR 386

Anti-EIF3H antibody

STJ115340 100 µl
EUR 277

Anti-EIF3H antibody

STJ119999 100 µl
EUR 413

Anti-EIF3H antibody

STJ29104 100 µl
EUR 277


ELI-09165h 96 Tests
EUR 824


ELI-26103b 96 Tests
EUR 928


EF009343 96 Tests
EUR 689

Rat EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3H shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif3h ELISA KIT

ELI-32670m 96 Tests
EUR 865


ELI-48145c 96 Tests
EUR 928

pCMV-SPORT6.1-EIF3H Plasmid

PVT16940 2 ug
EUR 325

EIF3H Recombinant Protein (Human)

RP010417 100 ug Ask for price

EIF3H Recombinant Protein (Rat)

RP199361 100 ug Ask for price

EIF3H Recombinant Protein (Mouse)

RP131288 100 ug Ask for price

[KO Validated] EIF3H Rabbit pAb

A18026-100ul 100 ul
EUR 410

[KO Validated] EIF3H Rabbit pAb

A18026-200ul 200 ul
EUR 571

[KO Validated] EIF3H Rabbit pAb

A18026-20ul 20 ul
EUR 221

[KO Validated] EIF3H Rabbit pAb

A18026-50ul 50 ul
EUR 287

Eif3h ORF Vector (Rat) (pORF)

ORF066455 1.0 ug DNA
EUR 506

EIF3H ORF Vector (Human) (pORF)

ORF003473 1.0 ug DNA
EUR 95

Eif3h ORF Vector (Mouse) (pORF)

ORF043764 1.0 ug DNA
EUR 506

pENTR223-EIF3H-G6A-A1047 vector

PVT11906 2 ug
EUR 308

EIF3H sgRNA CRISPR Lentivector set (Human)

K0668101 3 x 1.0 ug
EUR 339

Eif3h sgRNA CRISPR Lentivector set (Rat)

K7383001 3 x 1.0 ug
EUR 339

Eif3h sgRNA CRISPR Lentivector set (Mouse)

K4676501 3 x 1.0 ug
EUR 339

EIF3H sgRNA CRISPR Lentivector (Human) (Target 1)

K0668102 1.0 ug DNA
EUR 154

EIF3H sgRNA CRISPR Lentivector (Human) (Target 2)

K0668103 1.0 ug DNA
EUR 154

EIF3H sgRNA CRISPR Lentivector (Human) (Target 3)

K0668104 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 1)

K7383002 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 2)

K7383003 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Rat) (Target 3)

K7383004 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4676502 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4676503 1.0 ug DNA
EUR 154

Eif3h sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4676504 1.0 ug DNA
EUR 154

EIF3H Protein Vector (Mouse) (pPB-C-His)

PV175054 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPB-N-His)

PV175055 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPM-C-HA)

PV175056 500 ng
EUR 603

EIF3H Protein Vector (Mouse) (pPM-C-His)

PV175057 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPB-C-His)

PV265818 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPB-N-His)

PV265819 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPM-C-HA)

PV265820 500 ng
EUR 603

EIF3H Protein Vector (Rat) (pPM-C-His)

PV265821 500 ng
EUR 603

EIF3H Protein Vector (Human) (pPB-C-His)

PV013889 500 ng
EUR 329

Back to top