irak3 antibody

Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit

DLR-IRAK3-Hu-96T 96T
EUR 573
  • Should the Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit

RDR-IRAK3-Hu-48Tests 48 Tests
EUR 458

Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit

RDR-IRAK3-Hu-96Tests 96 Tests
EUR 633

Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit

RD-IRAK3-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 1 Receptor Associated Kinase 3 (IRAK3) ELISA Kit

RD-IRAK3-Hu-96Tests 96 Tests
EUR 606

IRAK3 antibody

22926-100ul 100ul
EUR 390

IRAK3 antibody

70R-12791 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IRAK3 antibody

IRAK3 Antibody

32867-100ul 100ul
EUR 252

IRAK3 Antibody

1-CSB-PA978564
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRAK3. Recognizes IRAK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

IRAK3 Antibody

DF7355 200ul
EUR 304
Description: IRAK3 Antibody detects endogenous levels of total IRAK3.

IRAK3 Antibody

1-CSB-PA556755
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRAK3. Recognizes IRAK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

IRAK3 Antibody

1-CSB-PA006792
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRAK3. Recognizes IRAK3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

IRAK3 antibody

70R-5023 50 ug
EUR 467
Description: Rabbit polyclonal IRAK3 antibody raised against the C terminal of IRAK3

IRAK3 antibody

70R-32240 100 ug
EUR 327
Description: Rabbit polyclonal IRAK3 antibody

IRAK3 Antibody

AF0690 200ul
EUR 304
Description: IRAK3 Antibody detects endogenous levels of IRAK3.

IRAK3 Antibody

AF4677 200ul
EUR 376
Description: IRAK3 Antibody detects endogenous levels of IRAK3.

IRAK3 Antibody

1-CSB-PA011811ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IRAK3. Recognizes IRAK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IRAK3 Antibody

1-CSB-PA011811ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IRAK3. Recognizes IRAK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

IRAK3 Antibody

ABD3487 100 ug
EUR 438

IRAK3 Antibody

ABD7355 100 ug
EUR 438

IRAK3 Antibody

ABF0690 100 ug
EUR 438

Mouse Irak3 Antibody

abx027920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Irak3 Antibody

abx027920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

IRAK3 Conjugated Antibody

C32867 100ul
EUR 397

Anti-IRAK3 antibody

STJ27420 100 µl
EUR 277
Description: This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants.

Anti-IRAK3 antibody

STJ115364 100 µl
EUR 277
Description: This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants.

Anti-IRAK3 Antibody

STJ501491 100 µg
EUR 476

IRAK3 siRNA

20-abx920782
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IRAK3 siRNA

20-abx920783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IRAK3

YF-PA27499 100 ul
EUR 403
Description: Rabbit polyclonal to IRAK3

Phospho-IRAK3(Ser510) Antibody

AF4377 200ul
EUR 376
Description: Phospho-IRAK3(Ser510) Antibody detects endogenous levels of IRAK3 only when phosphorylated at Ser510.

IRAK3 recombinant monoclonal antibody

A5332 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human IRAK3 for WB, IHC,ELISA

Anti-IRAKM/IRAK3 Antibody

PA2207-1 100ug/vial
EUR 294

Anti-IRAKM/IRAK3 Antibody

PA2207-2 100ug/vial
EUR 334

Anti-IRAK3 Antibody (Biotin)

STJ501492 100 µg
EUR 586

Anti-IRAK3 Antibody (FITC)

STJ501493 100 µg
EUR 586

Anti-IRAK3 (mouse) antibody

STJ71623 100 µg
EUR 359

IRAK3 Rabbit pAb

A13402-100ul 100 ul
EUR 308

IRAK3 Rabbit pAb

A13402-200ul 200 ul
EUR 459

IRAK3 Rabbit pAb

A13402-20ul 20 ul
EUR 183

IRAK3 Rabbit pAb

A13402-50ul 50 ul
EUR 223

IRAK3 Blocking Peptide

33R-6900 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IRAK3 antibody, catalog no. 70R-5023

IRAK3 Blocking Peptide

DF7355-BP 1mg
EUR 195

IRAK3 Blocking Peptide

20-abx061253
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IRAK3 Blocking Peptide

AF0690-BP 1mg
EUR 195

IRAK3 Blocking Peptide

AF4677-BP 1mg
EUR 195

IRAK3 cloning plasmid

CSB-CL011811HU-10ug 10ug
EUR 611
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1791
  • Sequence: atggcggggaactgtggggcccgcggcgcgctgtcggcgcacacgctgctgttcgacctgccgcccgcgctgctcggagagctctgcgctgttctggacagctgcgacggcgcgctgggctggcgcggcctggcagagagactttcaagcagctggctggatgttcgtcatattg
  • Show more
Description: A cloning plasmid for the IRAK3 gene.

IRAK3 Rabbit pAb

A5467-100ul 100 ul
EUR 308

IRAK3 Rabbit pAb

A5467-200ul 200 ul
EUR 459

IRAK3 Rabbit pAb

A5467-20ul 20 ul
EUR 183

IRAK3 Rabbit pAb

A5467-50ul 50 ul
EUR 223

Monoclonal IRAK3 Antibody, Clone: 6G9G2

APR16907G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human IRAK3. The antibodies are raised in Mouse and are from clone 6G9G2. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal IRAK3 Antibody, Clone: 5C3D6

APR16908G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human IRAK3. The antibodies are raised in Mouse and are from clone 5C3D6. This antibody is applicable in WB and IHC, FC, ICC, E

Rabbit Anti Human Irak3 Polyclonal Antibody

CPBT-65704RH 0.1 mg
EUR 663

Human IRAK3 ELISA Kit

ELA-E9261h 96 Tests
EUR 824

Human IRAK3 ELISA KIT

ELI-08254h 96 Tests
EUR 824

IRAK3 ELISA KIT|Human

EF006498 96 Tests
EUR 689

Mouse IRAK3 shRNA Plasmid

20-abx978041
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IRAK3 shRNA Plasmid

20-abx957682
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Irak3 ELISA KIT

ELI-38552m 96 Tests
EUR 865

Back to top