LEO1

LEO1 antibody

70R-18250 50 ul
EUR 435
Description: Rabbit polyclonal LEO1 antibody

LEO1 Antibody

37702-100ul 100ul
EUR 252

LEO1 Antibody

1-CSB-PA845150NA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

LEO1 Antibody

1-CSB-PA233075
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

LEO1 Antibody

1-CSB-PA012869GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LEO1 siRNA

20-abx902953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LEO1 siRNA

20-abx922435
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LEO1 siRNA

20-abx922436
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

20-abx113459
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

20-abx124867
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

abx031211-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

abx031211-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

20-abx242473
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody

abx234750-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Leo1 (pS551) Antibody

abx032033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leo1 (pS551) Antibody

abx032033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LEO1 (pS10) Antibody

abx032038-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

LEO1 (pS10) Antibody

abx032038-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LEO1 Conjugated Antibody

C37702 100ul
EUR 397

LEO1 cloning plasmid

CSB-CL845150HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2001
  • Sequence: atggcggatatggaggatctcttcgggagcgacgccgacagcgaagctgagcgtaaagattctgattctggatctgactcagattctgatcaagagaatgctgcctctggcagtaatgcctctggaagtgaaagtgatcaggatgaaagaggtgattcaggacaaccaagtaata
  • Show more
Description: A cloning plasmid for the LEO1 gene.

LEO1 Rabbit pAb

A8806-100ul 100 ul
EUR 308

LEO1 Rabbit pAb

A8806-200ul 200 ul
EUR 459

LEO1 Rabbit pAb

A8806-20ul 20 ul Ask for price

LEO1 Rabbit pAb

A8806-50ul 50 ul Ask for price

anti- LEO1 antibody

FNab04750 100µg
EUR 505.25
  • Immunogen: Leo1, Paf1/RNA polymerase II complex component, homolog(S. cerevisiae)
  • Uniprot ID: Q8WVC0
  • Gene ID: 123169
  • Research Area: Metabolism
Description: Antibody raised against LEO1

Anti-LEO1 antibody

PAab04750 100 ug
EUR 355

Anti-LEO1 antibody

STJ111425 100 µl
EUR 277

Human RNA polymerase- associated protein LEO1, LEO1 ELISA KIT

ELI-14447h 96 Tests
EUR 824

Mouse RNA polymerase- associated protein LEO1, Leo1 ELISA KIT

ELI-42132m 96 Tests
EUR 865

Human RNA Polymerase-Associated Protein LEO1 (LEO1) ELISA Kit

abx388257-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

LEO1 Antibody, HRP conjugated

1-CSB-PA845150NB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LEO1 Antibody, FITC conjugated

1-CSB-PA845150NC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LEO1 Antibody, Biotin conjugated

1-CSB-PA845150ND01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LEO1 ELISA KIT|Human

EF010656 96 Tests
EUR 689

Rat LEO1 shRNA Plasmid

20-abx989080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LEO1 shRNA Plasmid

20-abx964725
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LEO1 shRNA Plasmid

20-abx982215
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pMD19-T-LEO1 Plasmid

PVTB01141-1 2 ug
EUR 356

LEO1 Recombinant Protein (Human)

RP017683 100 ug Ask for price

LEO1 Recombinant Protein (Rat)

RP208007 100 ug Ask for price

LEO1 Recombinant Protein (Mouse)

RP147242 100 ug Ask for price

Leo1 ORF Vector (Rat) (pORF)

ORF069337 1.0 ug DNA
EUR 506

LEO1 ORF Vector (Human) (pORF)

ORF005895 1.0 ug DNA
EUR 95

Leo1 ORF Vector (Mouse) (pORF)

ORF049082 1.0 ug DNA
EUR 506

pMD19-T-LEO1(E225G) Plasmid

PVTB01141-2 2 ug
EUR 356

Leo1 sgRNA CRISPR Lentivector set (Mouse)

K4966701 3 x 1.0 ug
EUR 339

Leo1 sgRNA CRISPR Lentivector set (Rat)

K7139601 3 x 1.0 ug
EUR 339

LEO1 sgRNA CRISPR Lentivector set (Human)

K1208101 3 x 1.0 ug
EUR 339

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4966702 1.0 ug DNA
EUR 154

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4966703 1.0 ug DNA
EUR 154

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4966704 1.0 ug DNA
EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7139602 1.0 ug DNA
EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7139603 1.0 ug DNA
EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7139604 1.0 ug DNA
EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1208102 1.0 ug DNA
EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1208103 1.0 ug DNA
EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1208104 1.0 ug DNA
EUR 154

Recombinant human RNA polymerase-associated protein LEO1

P1518 100ug Ask for price
  • Uniprot ID: Q8WVC0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human RNA polymerase-associated protein LEO1

LEO1 Protein Vector (Human) (pPB-C-His)

PV023577 500 ng
EUR 329

LEO1 Protein Vector (Human) (pPB-N-His)

PV023578 500 ng
EUR 329

LEO1 Protein Vector (Human) (pPM-C-HA)

PV023579 500 ng
EUR 329

LEO1 Protein Vector (Human) (pPM-C-His)

PV023580 500 ng
EUR 329

LEO1 Protein Vector (Rat) (pPB-C-His)

PV277346 500 ng
EUR 1166

LEO1 Protein Vector (Rat) (pPB-N-His)

PV277347 500 ng
EUR 1166

LEO1 Protein Vector (Rat) (pPM-C-HA)

PV277348 500 ng
EUR 1166

LEO1 Protein Vector (Rat) (pPM-C-His)

PV277349 500 ng
EUR 1166

LEO1 Protein Vector (Mouse) (pPB-C-His)

PV196326 500 ng
EUR 1065

LEO1 Protein Vector (Mouse) (pPB-N-His)

PV196327 500 ng
EUR 1065

LEO1 Protein Vector (Mouse) (pPM-C-HA)

PV196328 500 ng
EUR 1065

LEO1 Protein Vector (Mouse) (pPM-C-His)

PV196329 500 ng
EUR 1065

Leo1 3'UTR Luciferase Stable Cell Line

TU111000 1.0 ml Ask for price

Leo1 3'UTR GFP Stable Cell Line

TU161000 1.0 ml Ask for price

Leo1 3'UTR Luciferase Stable Cell Line

TU207017 1.0 ml Ask for price

Leo1 3'UTR GFP Stable Cell Line

TU257017 1.0 ml Ask for price

LEO1 3'UTR GFP Stable Cell Line

TU062385 1.0 ml
EUR 1394

LEO1 3'UTR Luciferase Stable Cell Line

TU012385 1.0 ml
EUR 1394

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV670825 1.0 ug DNA
EUR 1355

LEO1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV670829 1.0 ug DNA
EUR 1355

LEO1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV670830 1.0 ug DNA
EUR 1355

Recombinant Saccharomyces Cerevisiae LEO1 Protein (aa 1-464) [His]

VAng-Wyb4935-1mg 1 mg
EUR 5052
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) Leo1, Paf1/RNA Polymerase II Complex Component, Homolog, recombinant protein.

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4966705 3 x 1.0 ug
EUR 376

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7139605 3 x 1.0 ug
EUR 376

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1208105 3 x 1.0 ug
EUR 376

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4966706 1.0 ug DNA
EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4966707 1.0 ug DNA
EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4966708 1.0 ug DNA
EUR 167

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV670826 1.0 ug DNA
EUR 1355

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV670827 1.0 ug DNA
EUR 1413

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV670828 1.0 ug DNA
EUR 1413

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7139606 1.0 ug DNA
EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7139607 1.0 ug DNA
EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7139608 1.0 ug DNA
EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1208106 1.0 ug DNA
EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1208107 1.0 ug DNA
EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1208108 1.0 ug DNA
EUR 167

Back to top