LEO1

LEO1 antibody
70R-18250	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LEO1 antibody

LEO1 Antibody
37702-100ul	SAB	100ul	EUR 252

LEO1 Antibody
1-CSB-PA845150NA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

LEO1 Antibody
1-CSB-PA233075	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

LEO1 Antibody
1-CSB-PA012869GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LEO1 siRNA
20-abx902953	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LEO1 siRNA
20-abx922435	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LEO1 siRNA
20-abx922436	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
20-abx113459	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
20-abx124867	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
abx031211-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
abx031211-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
20-abx242473	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RNA Polymerase-Associated Protein LEO1 (LEO1) Antibody
abx234750-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Leo1 (pS551) Antibody
abx032033-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Leo1 (pS551) Antibody
abx032033-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LEO1 (pS10) Antibody
abx032038-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

LEO1 (pS10) Antibody
abx032038-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LEO1 Conjugated Antibody
C37702	SAB	100ul	EUR 397

LEO1 cloning plasmid
CSB-CL845150HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2001 Sequence: atggcggatatggaggatctcttcgggagcgacgccgacagcgaagctgagcgtaaagattctgattctggatctgactcagattctgatcaagagaatgctgcctctggcagtaatgcctctggaagtgaaagtgatcaggatgaaagaggtgattcaggacaaccaagtaata Show more
Description: A cloning plasmid for the LEO1 gene.

LEO1 Rabbit pAb
A8806-100ul	Abclonal	100 ul	EUR 308

LEO1 Rabbit pAb
A8806-200ul	Abclonal	200 ul	EUR 459

LEO1 Rabbit pAb
A8806-20ul	Abclonal	20 ul	Ask for price

LEO1 Rabbit pAb
A8806-50ul	Abclonal	50 ul	Ask for price

anti- LEO1 antibody
FNab04750	FN Test	100µg	EUR 505.25
Immunogen: Leo1, Paf1/RNA polymerase II complex component, homolog(S. cerevisiae) Uniprot ID: Q8WVC0 Gene ID: 123169 Research Area: Metabolism
Description: Antibody raised against LEO1

Anti-LEO1 antibody
PAab04750	Lifescience Market	100 ug	EUR 355

Anti-LEO1 antibody
STJ111425	St John's Laboratory	100 µl	EUR 277

Human RNA polymerase- associated protein LEO1, LEO1 ELISA KIT
ELI-14447h	Lifescience Market	96 Tests	EUR 824

Mouse RNA polymerase- associated protein LEO1, Leo1 ELISA KIT
ELI-42132m	Lifescience Market	96 Tests	EUR 865

Human RNA Polymerase-Associated Protein LEO1 (LEO1) ELISA Kit
abx388257-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

LEO1 Antibody, HRP conjugated
1-CSB-PA845150NB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LEO1 Antibody, FITC conjugated
1-CSB-PA845150NC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LEO1 Antibody, Biotin conjugated
1-CSB-PA845150ND01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LEO1. Recognizes LEO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LEO1 ELISA KIT|Human
EF010656	Lifescience Market	96 Tests	EUR 689

Rat LEO1 shRNA Plasmid
20-abx989080	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LEO1 shRNA Plasmid
20-abx964725	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LEO1 shRNA Plasmid
20-abx982215	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pMD19-T-LEO1 Plasmid
PVTB01141-1	Lifescience Market	2 ug	EUR 356

LEO1 Recombinant Protein (Human)
RP017683	ABM	100 ug	Ask for price

LEO1 Recombinant Protein (Rat)
RP208007	ABM	100 ug	Ask for price

LEO1 Recombinant Protein (Mouse)
RP147242	ABM	100 ug	Ask for price

Leo1 ORF Vector (Rat) (pORF)
ORF069337	ABM	1.0 ug DNA	EUR 506

LEO1 ORF Vector (Human) (pORF)
ORF005895	ABM	1.0 ug DNA	EUR 95

Leo1 ORF Vector (Mouse) (pORF)
ORF049082	ABM	1.0 ug DNA	EUR 506

pMD19-T-LEO1(E225G) Plasmid
PVTB01141-2	Lifescience Market	2 ug	EUR 356

Leo1 sgRNA CRISPR Lentivector set (Mouse)
K4966701	ABM	3 x 1.0 ug	EUR 339

Leo1 sgRNA CRISPR Lentivector set (Rat)
K7139601	ABM	3 x 1.0 ug	EUR 339

LEO1 sgRNA CRISPR Lentivector set (Human)
K1208101	ABM	3 x 1.0 ug	EUR 339

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4966702	ABM	1.0 ug DNA	EUR 154

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4966703	ABM	1.0 ug DNA	EUR 154

Leo1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4966704	ABM	1.0 ug DNA	EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7139602	ABM	1.0 ug DNA	EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7139603	ABM	1.0 ug DNA	EUR 154

Leo1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7139604	ABM	1.0 ug DNA	EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1208102	ABM	1.0 ug DNA	EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1208103	ABM	1.0 ug DNA	EUR 154

LEO1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1208104	ABM	1.0 ug DNA	EUR 154

Recombinant human RNA polymerase-associated protein LEO1
P1518	FN Test	100ug	Ask for price
Uniprot ID: Q8WVC0 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human RNA polymerase-associated protein LEO1

LEO1 Protein Vector (Human) (pPB-C-His)
PV023577	ABM	500 ng	EUR 329

LEO1 Protein Vector (Human) (pPB-N-His)
PV023578	ABM	500 ng	EUR 329

LEO1 Protein Vector (Human) (pPM-C-HA)
PV023579	ABM	500 ng	EUR 329

LEO1 Protein Vector (Human) (pPM-C-His)
PV023580	ABM	500 ng	EUR 329

LEO1 Protein Vector (Rat) (pPB-C-His)
PV277346	ABM	500 ng	EUR 1166

LEO1 Protein Vector (Rat) (pPB-N-His)
PV277347	ABM	500 ng	EUR 1166

LEO1 Protein Vector (Rat) (pPM-C-HA)
PV277348	ABM	500 ng	EUR 1166

LEO1 Protein Vector (Rat) (pPM-C-His)
PV277349	ABM	500 ng	EUR 1166

LEO1 Protein Vector (Mouse) (pPB-C-His)
PV196326	ABM	500 ng	EUR 1065

LEO1 Protein Vector (Mouse) (pPB-N-His)
PV196327	ABM	500 ng	EUR 1065

LEO1 Protein Vector (Mouse) (pPM-C-HA)
PV196328	ABM	500 ng	EUR 1065

LEO1 Protein Vector (Mouse) (pPM-C-His)
PV196329	ABM	500 ng	EUR 1065

Leo1 3'UTR Luciferase Stable Cell Line
TU111000	ABM	1.0 ml	Ask for price

Leo1 3'UTR GFP Stable Cell Line
TU161000	ABM	1.0 ml	Ask for price

Leo1 3'UTR Luciferase Stable Cell Line
TU207017	ABM	1.0 ml	Ask for price

Leo1 3'UTR GFP Stable Cell Line
TU257017	ABM	1.0 ml	Ask for price

LEO1 3'UTR GFP Stable Cell Line
TU062385	ABM	1.0 ml	EUR 1394

LEO1 3'UTR Luciferase Stable Cell Line
TU012385	ABM	1.0 ml	EUR 1394

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV670825	ABM	1.0 ug DNA	EUR 1355

LEO1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV670829	ABM	1.0 ug DNA	EUR 1355

LEO1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV670830	ABM	1.0 ug DNA	EUR 1355

Recombinant Saccharomyces Cerevisiae LEO1 Protein (aa 1-464) [His]
VAng-Wyb4935-1mg	Creative Biolabs	1 mg	EUR 5052
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) Leo1, Paf1/RNA Polymerase II Complex Component, Homolog, recombinant protein.

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4966705	ABM	3 x 1.0 ug	EUR 376

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7139605	ABM	3 x 1.0 ug	EUR 376

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1208105	ABM	3 x 1.0 ug	EUR 376

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4966706	ABM	1.0 ug DNA	EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4966707	ABM	1.0 ug DNA	EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4966708	ABM	1.0 ug DNA	EUR 167

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV670826	ABM	1.0 ug DNA	EUR 1355

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV670827	ABM	1.0 ug DNA	EUR 1413

LEO1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV670828	ABM	1.0 ug DNA	EUR 1413

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7139606	ABM	1.0 ug DNA	EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7139607	ABM	1.0 ug DNA	EUR 167

Leo1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7139608	ABM	1.0 ug DNA	EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1208106	ABM	1.0 ug DNA	EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1208107	ABM	1.0 ug DNA	EUR 167

LEO1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1208108	ABM	1.0 ug DNA	EUR 167