Naoh Sds

Sds/ Rat Sds ELISA Kit

ELI-15462r 96 Tests
EUR 886

SDS Solution

2102-100
EUR 137

SDS antibody

10R-5712 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5718 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5720 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

70R-3627 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody

70R-3762 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS siRNA

20-abx904833
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932744
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134

anti-SDS

YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover

P5W12 NULL
EUR 0

100G SDS Ultrapure

NAT1072 100G
EUR 93

1KG SDS Ultrapure

NAT1074 1KG
EUR 306

10% SDS Solution

S0792-050 500ml
EUR 93

10% SDS Solution

S0792-100 2X500ml
EUR 122

20% SDS Solution

S0793-050 500ml
EUR 120

20% SDS Solution

S0793-100 2X500ml
EUR 166

SurfactAway™ SDS

SA645-30 30 mL
EUR 379

SurfactAway™ SDS

SA646-250 250 mL
EUR 1389

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)

YF-MA17551 100 ug
EUR 363
Description: Mouse monoclonal to SDS

AE-1390 SDS-eliminant

2332390 2unit
EUR 301
Description: SDS r emoval r eagent

Mouse Sds ELISA KIT

ELI-19881m 96 Tests
EUR 865

Human SDS ELISA KIT

ELI-29707h 96 Tests
EUR 824

SDS ELISA KIT|Human

EF005552 96 Tests
EUR 689

Bovine SDS ELISA KIT

ELI-53006b 96 Tests
EUR 928

Rat SDS shRNA Plasmid

20-abx984756
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SDS Polyclonal Conjugated Antibody

C27842 100ul
EUR 397

Human SDS shRNA Plasmid

20-abx957508
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SDS shRNA Plasmid

20-abx981902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

100ML SDS Solution 20%

NAT1228 100ML
EUR 77

450ML SDS Solution 20%

NAT1230 450ML
EUR 115

SDS, 99% Ultra Pure

S0800-100 1Kg
EUR 313

SDS, 99% Ultra Pure

S0800-250 2.5 Kg
EUR 536

SDS, 99% Ultra Pure

S0800-500 5 Kg
EUR 955

SDS Recombinant Protein (Human)

RP027868 100 ug Ask for price

SDS Recombinant Protein (Rat)

RP227840 100 ug Ask for price

SDS Recombinant Protein (Mouse)

RP170486 100 ug Ask for price

Residual SDS Detection Kit

BSP055 100Assays
EUR 83.06
  • Product category: Molecular Biology Kits/SDS Detection

SDS-Urea-Tris solution

SB8896 500ml
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS Buffer (Trisbase-Glycine-SDS) 10X Premix powder - 1PK(4L)

A0031 4L
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS-Blue™ - Coomassie based solution for protein staining in SDS-PAGE

04-GSB
  • EUR 120.00
  • EUR 80.00
  • 1L
  • 500mL


  • Working procedure:
    1) Invert the bottle a few times to ensure the solution is properly suspended.
    2) Take the gel out of the gel tank and submerse the gel in enough SDS-Blue to cover the gel.
    3) Bands will be visi
  • Show more
Description: SDS-Blue™ is an innovative patented formula, based on Coomassie blue, that comes in a convenient ready to use format for staining proteins in SDS-PAGE (sodium dodecyl sulphate–polyacrylamide gel electrophoresis). The formulation of SDS-Blue™ provides numerous advantages compared to the classic Coomassie staining or to other similar protein stains. SDS-Blue™ provides higher sensitivity, virtually no background and eliminates the need for destaining of the gel due to its high specificity and affinity to bind to protein only. Not only does SDS-Blue™ yield clear and sharp bands, but it also contains no methanol and acetic acid, making it non-hazardous, safe to handle and friendly to the environment when disposed of. Two other advantages that make SDS-Blue™ the better option is that it is not light sensitive and can be stored at ambient temperature for 24 months. And this provides a considerable convenience, especially to laboratories that need and keep big amount of protein staining solutions – no more jammed refrigerators, you can keep SDS-Blue™ wherever it is most convenient for You!

3X SDS-PAGE Loading Buffer

2108-10
EUR 158

SDS-PAGE Gel Preparation Kit

AR0138 1kit (Enough for 30-50 pieces of gel.)
EUR 96

Tricine SDS Sample Buffer 2X

AR1143 6mL (6*1mL)
EUR 65

Tris-Glycine SDS Buffer Pack

AR1149 1L/pack
EUR 55

SDS-PAGE Gel Preparation Kit

abx090646-1Kit 1 Kit
EUR 203
  • Shipped within 5-10 working days.

450ML 20X Tris-MOPS SDS

NAT1210 450ML
EUR 109

450ML 20X Tris-MEPS SDS

NAT1212 450ML
EUR 109

Sds ORF Vector (Rat) (pORF)

ORF075948 1.0 ug DNA
EUR 506

SDS ORF Vector (Human) (pORF)

ORF009290 1.0 ug DNA
EUR 95

Sds ORF Vector (Mouse) (pORF)

ORF056830 1.0 ug DNA
EUR 506

Sodium Dodecyl Sulfate (SDS) Ultrapure

S057-100G 100 g
EUR 61

Sodium Dodecyl Sulfate (SDS) Ultrapure

S057-1kG 1 kg
EUR 207

10X Tris-Glycine SDS buffer

T8053-050 500ml
EUR 85

10X Tris-Glycine SDS buffer

T8053-100 2X500ml
EUR 111

10X Tris-Glycine SDS buffer

T8053-101 1L
EUR 99

10X Tris-Glycine SDS buffer

T8053-104 4 L
EUR 153

10X Tris-Glycine SDS buffer

T8053-200 4X500ml
EUR 136

10X Tris-Glycine SDS buffer

T8053-201 2X1L
EUR 135

10X Tris-Glycine SDS buffer

T8053-401 4X1L
EUR 172

SDS, 10%(w/v) solution

SD8118 100ml
EUR 56.96
  • Product category: Biochemicals/Detergents/Surfactants

SDS, 20%(w/v) solution

SD8119 100ml
EUR 63.92
  • Product category: Biochemicals/Detergents/Surfactants

Sodium dodecyl sulphate (SDS) 0.5 g

09-2026-50 0,5 g
EUR 68

Tris-Glycine SDS Running Buffer Pack

AR0139 1L/pack (for 5 assyas)
EUR 55

SDS-PAGE Sample Loading Buffer (2x)

abx090647-5ml 5 ml
EUR 175
  • Shipped within 5-10 working days.

SDS-PAGE Sample Loading Buffer (5x)

abx090648-5ml 5 ml
EUR 189
  • Shipped within 5-10 working days.

SDS-PAGE Sample Loading Buffer (6x)

abx090649-5ml 5 ml
EUR 203
  • Shipped within 5-10 working days.

10x Tris-Glycine-SDS Buffer Solution

BA01807 6x100ml
EUR 103
Description: High purity buffer for various PCR applications.

Finegel SDS-PAGE Running Buffer(10X)

F1504-050 500ml
EUR 151

Finegel SDS-PAGE Running Buffer(10X)

F1504-100 2x500ml
EUR 201

Sds sgRNA CRISPR Lentivector set (Rat)

K6806501 3 x 1.0 ug
EUR 339

Sds sgRNA CRISPR Lentivector set (Mouse)

K3615401 3 x 1.0 ug
EUR 339

SDS sgRNA CRISPR Lentivector set (Human)

K2111301 3 x 1.0 ug
EUR 339

SDS-PAGE Resolving Gel Casting Solution

P9050-050 500ml
EUR 88

SDS-PAGE Resolving Gel Casting Solution

P9050-100 2X500ml
EUR 120

SDS-PAGE Stacking Gel Casting Solution

P9051-010 100ml
EUR 80

SDS-PAGE Stacking Gel Casting Solution

P9051-050 500ml
EUR 112

Human Serine Dehydratase(SDS)ELISA Kit

QY-E01421 96T
EUR 361

In Vitro SDS-K+ Precipitation Kit

TG1010-1 100 assays
EUR 459

Back to top