NUP62

Human Nucleoporin 62kDa (NUP62) ELISA Kit

DLR-NUP62-Hu-96T 96T
EUR 673
  • Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RDR-NUP62-Hu-48Tests 48 Tests
EUR 544

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RDR-NUP62-Hu-96Tests 96 Tests
EUR 756

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RD-NUP62-Hu-48Tests 48 Tests
EUR 521

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RD-NUP62-Hu-96Tests 96 Tests
EUR 723

Nup62/ Rat Nup62 ELISA Kit

ELI-13774r 96 Tests
EUR 886

NUP62 antibody

70R-19006 50 ul
EUR 435
Description: Rabbit polyclonal NUP62 antibody

NUP62 antibody

70R-2086 50 ug
EUR 467
Description: Rabbit polyclonal NUP62 antibody raised against the N terminal of NUP62

NUP62 Antibody

32676-100ul 100ul
EUR 252

NUP62 Antibody

DF6968 200ul
EUR 304
Description: NUP62 Antibody detects endogenous levels of total NUP62.

NUP62 Antibody

1-CSB-PA255769
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 Antibody

1-CSB-PA016204GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP62 Antibody

1-CSB-PA016204LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

NUP62 Antibody

1-CSB-PA041313
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 siRNA

20-abx903709
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP62 siRNA

20-abx926643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP62 siRNA

20-abx926644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP62 Antibody

ABD6968 100 ug
EUR 438

NUP62 Blocking Peptide

33R-8456 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP62 antibody, catalog no. 70R-2086

NUP62 Blocking Peptide

DF6968-BP 1mg
EUR 195

NUP62 Conjugated Antibody

C32676 100ul
EUR 397

NUP62 cloning plasmid

CSB-CL016204HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
  • Show more
Description: A cloning plasmid for the NUP62 gene.

NUP62 cloning plasmid

CSB-CL016204HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
  • Show more
Description: A cloning plasmid for the NUP62 gene.

NUP62 Rabbit pAb

A2499-100ul 100 ul
EUR 308

NUP62 Rabbit pAb

A2499-200ul 200 ul
EUR 459

NUP62 Rabbit pAb

A2499-20ul 20 ul
EUR 183

NUP62 Rabbit pAb

A2499-50ul 50 ul
EUR 223

NUP62 Polyclonal Antibody

ABP59565-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of NUP62 from Human, Mouse, Rat. This NUP62 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380

NUP62 Polyclonal Antibody

ABP59565-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of NUP62 from Human, Mouse, Rat. This NUP62 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380

NUP62 Polyclonal Antibody

ABP59565-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of NUP62 from Human, Mouse, Rat. This NUP62 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380

anti- NUP62 antibody

FNab05927 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: nucleoporin 62kDa
  • Uniprot ID: P37198
  • Gene ID: 23636
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP62

NUP62 Polyclonal Antibody

ES9942-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NUP62 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NUP62 Polyclonal Antibody

ES9942-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NUP62 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-NUP62 antibody

PAab05927 100 ug
EUR 355

Anti-NUP62 antibody

STJ24850 100 µl
EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform.

Anti-NUP62 antibody

STJ70481 100 µg
EUR 260

Anti-NUP62 antibody

STJ191100 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NUP62

NUP62 Antibody, HRP conjugated

1-CSB-PA016204LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP62 Antibody, FITC conjugated

1-CSB-PA016204LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP62 Antibody, Biotin conjugated

1-CSB-PA016204LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nucleoporin 62 (NUP62) Antibody

20-abx142112
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody

abx033433-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody

abx033433-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NUP62 ELISA KIT|Human

EF007020 96 Tests
EUR 689

Mouse NUP62 shRNA Plasmid

20-abx971843
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NUP62 shRNA Plasmid

20-abx986442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nucleoporin 62 (NUP62) Antibody

abx235927-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nucleoporin 62 (NUP62) Antibody

abx433060-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Human NUP62 shRNA Plasmid

20-abx958412
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nucleoporin 62 (NUP62) Antibody

20-abx001943
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Nucleoporin 62kDa (NUP62)

4-RPC257Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P37198
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Nucleoporin 62kDa expressed in: E.coli

Recombinant Nucleoporin 62 (NUP62)

4-RPC257Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17955
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.7kDa
  • Isoelectric Point: 5
Description: Recombinant Rat Nucleoporin 62 expressed in: E.coli

pCMV-SPORT6-NUP62 Plasmid

PVT16158 2 ug
EUR 325

NUP62 Recombinant Protein (Human)

RP021928 100 ug Ask for price

NUP62 Recombinant Protein (Human)

RP021931 100 ug Ask for price

NUP62 Recombinant Protein (Mouse)

RP155507 100 ug Ask for price

NUP62 Recombinant Protein (Rat)

RP214868 100 ug Ask for price

Human anti-Nuclear pore glycoprotein p62 IgG ELISA Kit, 96 tests, Quantitative

NUP62-100 1 Kit
EUR 712

Human anti-Nuclear pore glycoprotein p62 IgM ELISA Kit, 96 tests, Quantitative

NUP62-105 1 Kit
EUR 712

Mouse anti-Nuclear pore glycoprotein p62 IgG ELISA Kit, 96 tests, Quantitative

NUP62-110 1 Kit
EUR 712

Rat anti-Nuclear pore glycoprotein p62 IgG ELISA Kit, 96 tests, Quantitative

NUP62-120 1 Kit
EUR 712

Monkey anti-Nuclear pore glycoprotein p62 IgG ELISA Kit, 96 tests, Quantitative

NUP62-130 1 Kit
EUR 712

Polyclonal NUP62 Antibody (C-Term)

APG00435G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NUP62 (C-Term). This antibody is tested and proven to work in the following applications:

Nucleoporin 62 kDa (NUP62) Antibody

20-abx114230
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody

20-abx128968
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 62 kDa (NUP62) Antibody

20-abx173878
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nucleoporin 62 kDa (NUP62) Antibody

20-abx242160
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody

20-abx242161
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nup62 ORF Vector (Rat) (pORF)

ORF071624 1.0 ug DNA
EUR 506

NUP62 ORF Vector (Human) (pORF)

ORF007310 1.0 ug DNA
EUR 95

NUP62 ORF Vector (Human) (pORF)

ORF007311 1.0 ug DNA
EUR 95

Nup62 ORF Vector (Mouse) (pORF)

ORF051837 1.0 ug DNA
EUR 506

Nup62-il4i1 Recombinant Protein (Mouse)

RP155510 100 ug Ask for price

NUP62 ELISA Kit (Human) (OKCD01655)

OKCD01655 96 Wells
EUR 831
Description: Description of target: Essential component of the nuclear pore complex. The N-terminal is probably involved in nucleocytoplasmic transport. The C-terminal is probably involved in protein-protein interaction via coiled-coil formation and may function in anchorage of p62 to the pore complex. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

NUP62 ELISA Kit (Mouse) (OKWB00281)

OKWB00281 96 Wells
EUR 572
Description: Description of target: Essential component of the nuclear pore complex. The N-terminal is probably involved in nucleocytoplasmic transport. The C-terminal is involved in protein-protein interaction probably via coiled-coil formation, promotes its association with centrosomes and may function in anchorage of p62 to the pore complex. Plays a role in mitotic cell cycle progression by regulating centrosome segregation, centriole maturation and spindle orientation. It might be involved in protein recruitment to the centrosome after nuclear breakdown.;Species reactivity: Mouse;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

Human Nucleoporin 62 kDa (NUP62) Protein

20-abx166991
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human NUP62(Nucleoporin 62kDa) ELISA Kit

EH3462 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P37198
  • Alias: NUP62
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Polyclonal NUP62 Antibody (C-term E507)

APR05916G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP62 (C-term E507). This antibody is tested and proven to work in the following applications:

Human Nucleoporin 62 (NUP62) CLIA Kit

20-abx493571
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse NUP62(nucleoporin p62) ELISA Kit

EM1802 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

Nup62 sgRNA CRISPR Lentivector set (Rat)

K6957701 3 x 1.0 ug
EUR 339

Nup62 sgRNA CRISPR Lentivector set (Mouse)

K3958101 3 x 1.0 ug
EUR 339

NUP62 sgRNA CRISPR Lentivector set (Human)

K1468201 3 x 1.0 ug
EUR 339

Nup62-il4i1 ORF Vector (Mouse) (pORF)

ORF051838 1.0 ug DNA
EUR 506

NUP62 Nucleopurin 62kDa Human Recombinant Protein

PROTP37198 Regular: 20ug
EUR 317
Description: NUP62 Human Recombinant produced in SF9 is a glycosylated, polypeptide chain having a calculated molecular mass of 54,626 Dalton. ;NUP62 is expressed with a -10x His tag at N-terminus and purified by proprietary chromatographic techniques.

Human Nucleoporin 62kDa(NUP62)ELISA Kit

QY-E05189 96T
EUR 361

Human Nucleoporin 62kDa (NUP62) ELISA Kit

SEC257Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nucleoporin 62kDa (NUP62) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nucleoporin 62kDa (NUP62) in Tissue homogenates and other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

SEC257Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nucleoporin 62kDa (NUP62) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nucleoporin 62kDa (NUP62) in Tissue homogenates and other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

SEC257Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nucleoporin 62kDa (NUP62) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nucleoporin 62kDa (NUP62) in Tissue homogenates and other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

SEC257Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nucleoporin 62kDa (NUP62) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nucleoporin 62kDa (NUP62) in Tissue homogenates and other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

4-SEC257Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nucleoporin 62kDa elisa. Alternative names of the recognized antigen: IBSN
  • p62
  • SNDI
  • Nuclear Pore Glycoprotein p62
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nucleoporin 62kDa (NUP62) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Nucleoporin p62 (NUP62) Elisa Kit

QY-E21705 96T
EUR 374

CLIA kit for Human NUP62 (Nucleoporin 62kDa)

E-CL-H1403 1 plate of 96 wells
EUR 584
  • Gentaur's NUP62 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human NUP62 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human NUP62 (Nucleoporin 62kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NUP62 (Nucleoporin 62kDa)

E-EL-H2398 1 plate of 96 wells
EUR 534
  • Gentaur's NUP62 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NUP62. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NUP62 (Nucleoporin 62kDa) in samples from Serum, Plasma, Cell supernatant

Human Nucleoporin 62 kDa (NUP62) CLIA Kit

abx197370-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Back to top