PSMC2

PSMC2 antibody

70R-19592 50 ul
EUR 435
Description: Rabbit polyclonal PSMC2 antibody

PSMC2 Antibody

32536-100ul 100ul
EUR 252

PSMC2 Antibody

1-CSB-PA134529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC2. Recognizes PSMC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMC2 Antibody

1-CSB-PA946590
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC2. Recognizes PSMC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMC2 Antibody

DF6736 200ul
EUR 304
Description: PSMC2 Antibody detects endogenous levels of total PSMC2.

PSMC2 Antibody

1-CSB-PA018890GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMC2. Recognizes PSMC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PSMC2 siRNA

20-abx930162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC2 siRNA

20-abx930163
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC2 Antibody

ABD6736 100 ug
EUR 438

PSMC2 Blocking Peptide

DF6736-BP 1mg
EUR 195

PSMC2 Conjugated Antibody

C32536 100ul
EUR 397

PSMC2 cloning plasmid

CSB-CL018890HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgccggattacctcggtgccgatcagcggaagaccaaagaggatgagaaggacgacaagcccatccgagctctggatgagggggatattgccttgttgaaaacttatggtcagagcacttactctaggcagatcaagcaagttgaagatgacattcagcaacttctcaagaaaa
  • Show more
Description: A cloning plasmid for the PSMC2 gene.

PSMC2 Rabbit pAb

A3195-100ul 100 ul
EUR 308

PSMC2 Rabbit pAb

A3195-200ul 200 ul
EUR 459

PSMC2 Rabbit pAb

A3195-20ul 20 ul Ask for price

PSMC2 Rabbit pAb

A3195-50ul 50 ul Ask for price

PSMC2 Rabbit pAb

A1985-100ul 100 ul
EUR 308

PSMC2 Rabbit pAb

A1985-200ul 200 ul
EUR 459

PSMC2 Rabbit pAb

A1985-20ul 20 ul
EUR 183

PSMC2 Rabbit pAb

A1985-50ul 50 ul
EUR 223

anti- PSMC2 antibody

FNab06878 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, ATPase, 2
  • Uniprot ID: P35998
  • Gene ID: 5701
  • Research Area: Metabolism
Description: Antibody raised against PSMC2

Anti-PSMC2 antibody

PAab06878 100 ug
EUR 355

Anti-PSMC2 antibody

STJ111174 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit has been shown to interact with several of the basal transcription factors so, in addition to participation in proteasome functions, this subunit may participate in the regulation of transcription. This subunit may also compete with PSMC3 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-PSMC2 antibody

STJ25180 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit has been shown to interact with several of the basal transcription factors so, in addition to participation in proteasome functions, this subunit may participate in the regulation of transcription. This subunit may also compete with PSMC3 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

PSMC2 ELISA KIT|Human

EF002120 96 Tests
EUR 689

Rat PSMC2 shRNA Plasmid

20-abx985138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMC2 shRNA Plasmid

20-abx953848
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC2 Recombinant Protein (Human)

RP024958 100 ug Ask for price

PSMC2 Recombinant Protein (Mouse)

RP165296 100 ug Ask for price

PSMC2 Recombinant Protein (Rat)

RP222638 100 ug Ask for price

Polyclonal PSMC2 Antibody (N-term)

APR03979G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC2 (N-term). This antibody is tested and proven to work in the following applications:

Psmc2 ORF Vector (Rat) (pORF)

ORF074214 1.0 ug DNA
EUR 506

PSMC2 ORF Vector (Human) (pORF)

ORF008320 1.0 ug DNA
EUR 95

Psmc2 ORF Vector (Mouse) (pORF)

ORF055100 1.0 ug DNA
EUR 506

[One Step] PSMC2 Antibody Kit

RK05691 50 ul
EUR 240

Psmc2 sgRNA CRISPR Lentivector set (Rat)

K6786701 3 x 1.0 ug
EUR 339

Psmc2 sgRNA CRISPR Lentivector set (Mouse)

K4585101 3 x 1.0 ug
EUR 339

PSMC2 sgRNA CRISPR Lentivector set (Human)

K1740901 3 x 1.0 ug
EUR 339

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

abx028160-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

abx028160-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx103498
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx114741
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx127018
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx141654
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx242174
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx242175
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

abx236878-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Proteasome 26S Subunit, ATPase 2 (PSMC2) Antibody

20-abx001617
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Psmc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6786702 1.0 ug DNA
EUR 154

Psmc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6786703 1.0 ug DNA
EUR 154

Psmc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6786704 1.0 ug DNA
EUR 154

Psmc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4585102 1.0 ug DNA
EUR 154

Psmc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4585103 1.0 ug DNA
EUR 154

Psmc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4585104 1.0 ug DNA
EUR 154

PSMC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1740902 1.0 ug DNA
EUR 154

Back to top