PSMD9

PSMD9 Antibody

32797-100ul 100ul
EUR 252

PSMD9 Antibody

DF9094 200ul
EUR 304
Description: PSMD9 Antibody detects endogenous levels of total PSMD9.

PSMD9 Antibody

1-CSB-PA576314
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMD9 Antibody

1-CSB-PA212713
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMD9 antibody

70R-9748 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PSMD9 antibody

PSMD9 antibody

70R-9749 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PSMD9 antibody

PSMD9 Antibody

1-CSB-PA018914LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PSMD9 siRNA

20-abx904328
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD9 siRNA

20-abx930200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD9 siRNA

20-abx930201
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD9 Antibody

ABD9094 100 ug
EUR 438

anti-PSMD9

YF-PA14141 50 ul
EUR 363
Description: Mouse polyclonal to PSMD9

anti-PSMD9

YF-PA14142 50 ug
EUR 363
Description: Mouse polyclonal to PSMD9

anti-PSMD9

YF-PA14143 100 ug
EUR 403
Description: Rabbit polyclonal to PSMD9

Human PSMD9 Antibody

33419-05111 150 ug
EUR 261

PSMD9 Blocking Peptide

DF9094-BP 1mg
EUR 195

PSMD9 Conjugated Antibody

C32797 100ul
EUR 397

PSMD9 cloning plasmid

CSB-CL018914HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgtccgacgaggaagcgaggcagagcggaggctcctcgcaggccggcgtcgtgactgtcagcgacgtccaggagctgatgcggcgcaaggaggagatagaagcgcagatcaaggccaactatgacgtgctggaaagccaaaaaggcattgggatgaacgagccgctggtggactg
  • Show more
Description: A cloning plasmid for the PSMD9 gene.

PSMD9 Rabbit pAb

A5357-100ul 100 ul
EUR 308

PSMD9 Rabbit pAb

A5357-200ul 200 ul
EUR 459

PSMD9 Rabbit pAb

A5357-20ul 20 ul
EUR 183

PSMD9 Rabbit pAb

A5357-50ul 50 ul
EUR 223

PSMD9 Polyclonal Antibody

ABP60021-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PSMD9 from Human, Mouse, Rat. This PSMD9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120

PSMD9 Polyclonal Antibody

ABP60021-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PSMD9 from Human, Mouse, Rat. This PSMD9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120

PSMD9 Polyclonal Antibody

ABP60021-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of PSMD9 from Human, Mouse, Rat. This PSMD9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PSMD9 protein at amino acid sequence of 40-120

PSMD9 Polyclonal Antibody

ES9289-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSMD9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSMD9 Polyclonal Antibody

ES9289-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSMD9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-PSMD9 (3A4)

LF-MA10260 100 ug
EUR 363
Description: Mouse monoclonal to PSMD9

Anti-PSMD9 antibody

STJ27310 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene.

Anti-PSMD9 antibody

STJ190447 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PSMD9

PSMD9 protein (His tag)

80R-2582 100 ug
EUR 322
Description: Purified recombinant PSMD9 protein

Mouse Psmd9 ELISA KIT

ELI-12805m 96 Tests
EUR 865

Human PSMD9 ELISA KIT

ELI-15698h 96 Tests
EUR 824

Rat PSMD9 shRNA Plasmid

20-abx987574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMD9 shRNA Plasmid

20-abx976003
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD9 Antibody, HRP conjugated

1-CSB-PA018914LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMD9 Antibody, FITC conjugated

1-CSB-PA018914LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMD9 Antibody, Biotin conjugated

1-CSB-PA018914LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMD9. Recognizes PSMD9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMD9 shRNA Plasmid

20-abx953860
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine PSMD9 ELISA KIT

ELI-36904b 96 Tests
EUR 928

PSMD9 Recombinant Protein (Human)

RP025018 100 ug Ask for price

PSMD9 Recombinant Protein (Mouse)

RP165356 100 ug Ask for price

PSMD9 Recombinant Protein (Rat)

RP222695 100 ug Ask for price

Human PSMD9 Antibody (Biotin Conjugate)

33419-05121 150 ug
EUR 369

Psmd9 ORF Vector (Rat) (pORF)

ORF074233 1.0 ug DNA
EUR 506

PSMD9 ORF Vector (Human) (pORF)

ORF008340 1.0 ug DNA
EUR 95

Psmd9 ORF Vector (Mouse) (pORF)

ORF055120 1.0 ug DNA
EUR 506

Human PSMD9 AssayLite Antibody (FITC Conjugate)

33419-05141 150 ug
EUR 428

Human PSMD9 AssayLite Antibody (RPE Conjugate)

33419-05151 150 ug
EUR 428

Human PSMD9 AssayLite Antibody (APC Conjugate)

33419-05161 150 ug
EUR 428

Human PSMD9 AssayLite Antibody (PerCP Conjugate)

33419-05171 150 ug
EUR 471

Psmd9 sgRNA CRISPR Lentivector set (Rat)

K7125501 3 x 1.0 ug
EUR 339

Psmd9 sgRNA CRISPR Lentivector set (Mouse)

K3737001 3 x 1.0 ug
EUR 339

PSMD9 sgRNA CRISPR Lentivector set (Human)

K1743001 3 x 1.0 ug
EUR 339

Monoclonal PSMD9 Antibody (monoclonal) (M01), Clone: 3A4

AMM03962G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PSMD9 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3A4. This antibody is applicable in WB, E

Back to top