PSME3

Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit

DLR-PSME3-Hu-96T 96T
EUR 673
  • Should the Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Proteasome Activator Subunit 3 (PSME3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit

RDR-PSME3-Hu-48Tests 48 Tests
EUR 544

Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit

RDR-PSME3-Hu-96Tests 96 Tests
EUR 756

Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit

RD-PSME3-Hu-48Tests 48 Tests
EUR 521

Human Proteasome Activator Subunit 3 (PSME3) ELISA Kit

RD-PSME3-Hu-96Tests 96 Tests
EUR 723

PSME3 antibody

22679-100ul 100ul
EUR 390

PSME3 antibody

70R-19609 50 ul
EUR 435
Description: Rabbit polyclonal PSME3 antibody

PSME3 antibody

70R-1072 100 ug
EUR 377
Description: Rabbit polyclonal PSME3 antibody raised against the C terminal of PSME3

PSME3 antibody

70R-13032 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PSME3 antibody

PSME3 antibody

70R-2344 50 ug
EUR 467
Description: Rabbit polyclonal PSME3 antibody raised against the N terminal of PSME3

PSME3 antibody

70R-15446 100 ug
EUR 327
Description: Rabbit polyclonal PSME3 antibody

PSME3 Antibody

32056-100ul 100ul
EUR 252

PSME3 Antibody

1-CSB-PA13674A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME3. Recognizes PSME3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PSME3 Antibody

DF6074 200ul
EUR 304
Description: PSME3 Antibody detects endogenous levels of total PSME3.

PSME3 Antibody

1-CSB-PA018918GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSME3. Recognizes PSME3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PSME3 siRNA

20-abx930206
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSME3 siRNA

20-abx930207
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSME3 Antibody

ABD6074 100 ug
EUR 438

pENTR223-PSME3

PVT12707 2 ug
EUR 391

pOTB7-PSME3

PVT18692 2 ug
EUR 231

anti-PSME3

YF-PA16779 50 ul
EUR 363
Description: Mouse polyclonal to PSME3

anti-PSME3

YF-PA16780 50 ug
EUR 363
Description: Mouse polyclonal to PSME3

PSME3 Rabbit pAb

A12697-100ul 100 ul
EUR 308

PSME3 Rabbit pAb

A12697-200ul 200 ul
EUR 459

PSME3 Rabbit pAb

A12697-20ul 20 ul
EUR 183

PSME3 Rabbit pAb

A12697-50ul 50 ul
EUR 223

PSME3 Blocking Peptide

33R-9372 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSME3 antibody, catalog no. 70R-1072

PSME3 Blocking Peptide

33R-7157 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSME3 antibody, catalog no. 70R-2344

PSME3 antibody (HRP)

60R-2151 100 ug
EUR 327
Description: Rabbit polyclonal PSME3 antibody (HRP)

PSME3 antibody (FITC)

60R-2152 100 ug
EUR 327
Description: Rabbit polyclonal PSME3 antibody (FITC)

PSME3 antibody (biotin)

60R-2153 100 ug
EUR 327
Description: Rabbit polyclonal PSME3 antibody (biotin)

PSME3 Blocking Peptide

DF6074-BP 1mg
EUR 195

PSME3 Rabbit pAb

A0271-100ul 100 ul
EUR 308

PSME3 Rabbit pAb

A0271-200ul 200 ul
EUR 459

PSME3 Rabbit pAb

A0271-20ul 20 ul
EUR 183

PSME3 Rabbit pAb

A0271-50ul 50 ul
EUR 223

PSME3 Conjugated Antibody

C32056 100ul
EUR 397

PSME3 cloning plasmid

CSB-CL018918HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctcgttgctgaaggtggatcaggaagtgaagctcaaggttgattctttcagggagcggatcacaagtgaggcagaagacttggtggcaaattttttcccaaagaagttattagaacttgatagttttctgaaggaaccaatcttaaacatccatgacctaactcagatcca
  • Show more
Description: A cloning plasmid for the PSME3 gene.

PSME3 Polyclonal Antibody

A52301 100 µg
EUR 570.55
Description: Ask the seller for details

anti- PSME3 antibody

FNab06896 100µg
EUR 505.25
  • Immunogen: proteasome(prosome, macropain) activator subunit 3(PA28 gamma
  • Ki)
  • Uniprot ID: P61289
  • Gene ID: 10197
  • Research Area: Cancer, Metabolism
Description: Antibody raised against PSME3

Anti-PSME3 antibody

PAab06896 100 ug
EUR 355

Anti-PSME3 antibody

STJ25192 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants.

Anti-PSME3 antibody

STJ114570 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants.

Anti-PSME3 antibody

STJ119994 100 µl
EUR 413
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants.

PSME3 Antibody, HRP conjugated

1-CSB-PA13674B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME3. Recognizes PSME3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSME3 Antibody, FITC conjugated

1-CSB-PA13674C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME3. Recognizes PSME3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSME3 Antibody, Biotin conjugated

1-CSB-PA13674D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME3. Recognizes PSME3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSME3 ELISA KIT|Human

EF002139 96 Tests
EUR 689

Mouse PSME3 shRNA Plasmid

20-abx972252
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSME3 Polyclonal Conjugated Antibody

C30261 100ul
EUR 397

Human PSME3 shRNA Plasmid

20-abx956886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSME3 Recombinant Protein (Human)

RP025030 100 ug Ask for price

PSME3 Recombinant Protein (Mouse)

RP165368 100 ug Ask for price

PSME3 Recombinant Protein (Rat)

RP222704 100 ug Ask for price

[KO Validated] PSME3 Polyclonal Antibody

30261-100ul 100ul
EUR 252

Back to top