RAB4A

RAB4A antibody
70R-19718	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RAB4A antibody

RAB4A antibody
39123-100ul	SAB	100ul	EUR 252

Rab4A Antibody
48632-100ul	SAB	100ul	EUR 333

Rab4A Antibody
48632-50ul	SAB	50ul	EUR 239

RAB4A Antibody
39710-100ul	SAB	100ul	EUR 390

RAB4A Antibody
BF0586	Affbiotech	200ul	EUR 376
Description: RAB4A antibody detects endogenous levels of total RAB4A.

RAB4A Antibody
1-CSB-PA019211ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB4A Antibody
1-CSB-PA019211ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAB4A Antibody
1-CSB-PA019211GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

RAB4A siRNA
20-abx904431	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB4A siRNA
20-abx930689	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB4A siRNA
20-abx930690	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
20-abx005149	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
20-abx125386	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
abx037919-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
abx011709-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
20-abx320067	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
abx237037-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody
20-abx322221	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

RAB4A Rabbit pAb
A13540-100ul	Abclonal	100 ul	EUR 308

RAB4A Rabbit pAb
A13540-200ul	Abclonal	200 ul	EUR 459

RAB4A Rabbit pAb
A13540-20ul	Abclonal	20 ul	EUR 183

RAB4A Rabbit pAb
A13540-50ul	Abclonal	50 ul	EUR 223

Rab4A Conjugated Antibody
C48632	SAB	100ul	EUR 397

RAB4A Conjugated Antibody
C39123	SAB	100ul	EUR 397

RAB4A Blocking Peptide
BF0586-BP	Affbiotech	1mg	EUR 195

RAB4A cloning plasmid
CSB-CL019211HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: atgtcgcagacggccatgtccgaaacctacgattttttgtttaagttcttggttattggaaatgcaggaactggcaaatcttgcttacttcatcagtttattgaaaaaaaattcaaagatgactcaaatcatacaataggagtggaatttggttcaaagataataaatgttggtgg Show more
Description: A cloning plasmid for the RAB4A gene.

Monoclonal RAB4A Antibody
AMM03164G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human RAB4A. The antibodies are raised in Mouse. This antibody is applicable in WB

RAB4A Rabbit mAb
A3979-100ul	Abclonal	100 ul	EUR 410

RAB4A Rabbit mAb
A3979-200ul	Abclonal	200 ul	EUR 571

RAB4A Rabbit mAb
A3979-20ul	Abclonal	20 ul	EUR 221

RAB4A Rabbit mAb
A3979-50ul	Abclonal	50 ul	EUR 287

RAB4A Rabbit pAb
A6712-100ul	Abclonal	100 ul	EUR 308

RAB4A Rabbit pAb
A6712-200ul	Abclonal	200 ul	EUR 459

RAB4A Rabbit pAb
A6712-20ul	Abclonal	20 ul	EUR 183

RAB4A Rabbit pAb
A6712-50ul	Abclonal	50 ul	EUR 223

anti- RAB4A antibody
FNab07037	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 IHC: 1:50-1:500 IF: 1:20-1:200 Immunogen: RAB4A, member RAS oncogene family Uniprot ID: P20338 Gene ID: 5867 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB4A

anti-RAB4A (4E11)
LF-MA30733	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to RAB4A

Anti-RAB4A antibody
PAab07037	Lifescience Market	100 ug	EUR 355

Anti-RAB4A antibody
STJ28795	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene.

Anti-RAB4A antibody
STJ115501	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene.

Anti-RAB4A antibody
STJ99152	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to RAB4A.

Polyclonal RAB4A / RAB4 Antibody
APR03007G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB4A / RAB4 . This antibody is tested and proven to work in the following applications:

RAB4A protein (His tag)
80R-1863	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant RAB4A protein

RAB4A ELISA KIT|Human
EF002253	Lifescience Market	96 Tests	EUR 689

Mouse RAB4A shRNA Plasmid
20-abx972347	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RAB4A shRNA Plasmid
20-abx985100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RAB4A shRNA Plasmid
20-abx953957	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rab4A recombinant monoclonal antibody
A5056	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Rab4A for WB, IHC,ELISA

RAB4A Recombinant Protein (Human)
RP025528	ABM	100 ug	Ask for price

RAB4A Recombinant Protein (Mouse)
RP166346	ABM	100 ug	Ask for price

RAB4A Recombinant Protein (Rat)
RP223364	ABM	100 ug	Ask for price

Monoclonal RAB4A Antibody, Clone: 4E11
AMM02898G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human RAB4A. The antibodies are raised in Mouse and are from clone 4E11. This antibody is applicable in WB and IHC, FC, E

Rab4a ORF Vector (Rat) (pORF)
ORF074456	ABM	1.0 ug DNA	EUR 506

RAB4A ORF Vector (Human) (pORF)
ORF008510	ABM	1.0 ug DNA	EUR 95

Rab4a ORF Vector (Mouse) (pORF)
ORF055450	ABM	1.0 ug DNA	EUR 506

Rab4A, Member Ras Oncogene Family Antibody
20-abx114996	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family Protein
20-abx262904	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Rab4a sgRNA CRISPR Lentivector set (Rat)
K6790901	ABM	3 x 1.0 ug	EUR 339

Rab4a sgRNA CRISPR Lentivector set (Mouse)
K3769901	ABM	3 x 1.0 ug	EUR 339

RAB4A sgRNA CRISPR Lentivector set (Human)
K1769201	ABM	3 x 1.0 ug	EUR 339

Anti-Rab4A/Rab4 Rabbit Monoclonal Antibody
M04643	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Rab4A/Rab4 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Recombinant Human RAB4A, Member RAS Oncogene Family
7-05989	CHI Scientific	2µg	Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family
7-05990	CHI Scientific	10µg	Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family
7-05991	CHI Scientific	1mg	Ask for price

Human Ras-related protein Rab-4A (RAB4A)
1-CSB-EP019211HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-4A(RAB4A) expressed in E.coli

Ras-Related Protein Rab-4A (RAB4A) Antibody
20-abx445146	Abbexa	EUR 467.00 EUR 314.00	100 ul 25 ul
Shipped within 5-12 working days.

Monoclonal RAB4A Antibody (monoclonal) (M01), Clone: 1C10
AMM03978G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RAB4A (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C10. This antibody is applicable in WB, E

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6790902	ABM	1.0 ug DNA	EUR 154

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6790903	ABM	1.0 ug DNA	EUR 154

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6790904	ABM	1.0 ug DNA	EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3769902	ABM	1.0 ug DNA	EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3769903	ABM	1.0 ug DNA	EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3769904	ABM	1.0 ug DNA	EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 1)
K1769202	ABM	1.0 ug DNA	EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 2)
K1769203	ABM	1.0 ug DNA	EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 3)
K1769204	ABM	1.0 ug DNA	EUR 154

RAB4A Protein Vector (Rat) (pPB-C-His)
PV297822	ABM	500 ng	EUR 603

RAB4A Protein Vector (Rat) (pPB-N-His)
PV297823	ABM	500 ng	EUR 603

RAB4A Protein Vector (Rat) (pPM-C-HA)
PV297824	ABM	500 ng	EUR 603

RAB4A Protein Vector (Rat) (pPM-C-His)
PV297825	ABM	500 ng	EUR 603

RAB4A Protein Vector (Human) (pPB-C-His)
PV034037	ABM	500 ng	EUR 329

RAB4A Protein Vector (Human) (pPB-N-His)
PV034038	ABM	500 ng	EUR 329

RAB4A Protein Vector (Human) (pPM-C-HA)
PV034039	ABM	500 ng	EUR 329

RAB4A Protein Vector (Human) (pPM-C-His)
PV034040	ABM	500 ng	EUR 329