RAB4A

RAB4A antibody

70R-19718 50 ul
EUR 435
Description: Rabbit polyclonal RAB4A antibody

RAB4A antibody

39123-100ul 100ul
EUR 252

Rab4A Antibody

48632-100ul 100ul
EUR 333

Rab4A Antibody

48632-50ul 50ul
EUR 239

RAB4A Antibody

39710-100ul 100ul
EUR 390

RAB4A Antibody

BF0586 200ul
EUR 376
Description: RAB4A antibody detects endogenous levels of total RAB4A.

RAB4A Antibody

1-CSB-PA019211ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB4A Antibody

1-CSB-PA019211ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAB4A Antibody

1-CSB-PA019211GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB4A. Recognizes RAB4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

RAB4A siRNA

20-abx904431
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB4A siRNA

20-abx930689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB4A siRNA

20-abx930690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

20-abx005149
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

20-abx125386
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

abx037919-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

abx011709-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

20-abx320067
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

abx237037-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB4A, Member RAS Oncogene Family (RAB4A) Antibody

20-abx322221
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB4A Rabbit pAb

A13540-100ul 100 ul
EUR 308

RAB4A Rabbit pAb

A13540-200ul 200 ul
EUR 459

RAB4A Rabbit pAb

A13540-20ul 20 ul
EUR 183

RAB4A Rabbit pAb

A13540-50ul 50 ul
EUR 223

Rab4A Conjugated Antibody

C48632 100ul
EUR 397

RAB4A Conjugated Antibody

C39123 100ul
EUR 397

RAB4A Blocking Peptide

BF0586-BP 1mg
EUR 195

RAB4A cloning plasmid

CSB-CL019211HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgtcgcagacggccatgtccgaaacctacgattttttgtttaagttcttggttattggaaatgcaggaactggcaaatcttgcttacttcatcagtttattgaaaaaaaattcaaagatgactcaaatcatacaataggagtggaatttggttcaaagataataaatgttggtgg
  • Show more
Description: A cloning plasmid for the RAB4A gene.

Monoclonal RAB4A Antibody

AMM03164G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RAB4A. The antibodies are raised in Mouse. This antibody is applicable in WB

RAB4A Rabbit mAb

A3979-100ul 100 ul
EUR 410

RAB4A Rabbit mAb

A3979-200ul 200 ul
EUR 571

RAB4A Rabbit mAb

A3979-20ul 20 ul
EUR 221

RAB4A Rabbit mAb

A3979-50ul 50 ul
EUR 287

RAB4A Rabbit pAb

A6712-100ul 100 ul
EUR 308

RAB4A Rabbit pAb

A6712-200ul 200 ul
EUR 459

RAB4A Rabbit pAb

A6712-20ul 20 ul
EUR 183

RAB4A Rabbit pAb

A6712-50ul 50 ul
EUR 223

anti- RAB4A antibody

FNab07037 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: RAB4A, member RAS oncogene family
  • Uniprot ID: P20338
  • Gene ID: 5867
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB4A

anti-RAB4A (4E11)

LF-MA30733 100 ul
EUR 527
Description: Mouse Monoclonal to RAB4A

Anti-RAB4A antibody

PAab07037 100 ug
EUR 355

Anti-RAB4A antibody

STJ28795 100 µl
EUR 277
Description: This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene.

Anti-RAB4A antibody

STJ115501 100 µl
EUR 277
Description: This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene.

Anti-RAB4A antibody

STJ99152 200 µl
EUR 197
Description: Mouse monoclonal to RAB4A.

Polyclonal RAB4A / RAB4 Antibody

APR03007G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB4A / RAB4 . This antibody is tested and proven to work in the following applications:

RAB4A protein (His tag)

80R-1863 100 ug
EUR 305
Description: Purified recombinant RAB4A protein

RAB4A ELISA KIT|Human

EF002253 96 Tests
EUR 689

Mouse RAB4A shRNA Plasmid

20-abx972347
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB4A shRNA Plasmid

20-abx985100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB4A shRNA Plasmid

20-abx953957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rab4A recombinant monoclonal antibody

A5056 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Rab4A for WB, IHC,ELISA

RAB4A Recombinant Protein (Human)

RP025528 100 ug Ask for price

RAB4A Recombinant Protein (Mouse)

RP166346 100 ug Ask for price

RAB4A Recombinant Protein (Rat)

RP223364 100 ug Ask for price

Monoclonal RAB4A Antibody, Clone: 4E11

AMM02898G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RAB4A. The antibodies are raised in Mouse and are from clone 4E11. This antibody is applicable in WB and IHC, FC, E

Rab4a ORF Vector (Rat) (pORF)

ORF074456 1.0 ug DNA
EUR 506

RAB4A ORF Vector (Human) (pORF)

ORF008510 1.0 ug DNA
EUR 95

Rab4a ORF Vector (Mouse) (pORF)

ORF055450 1.0 ug DNA
EUR 506

Rab4A, Member Ras Oncogene Family Antibody

20-abx114996
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB4A, Member RAS Oncogene Family Protein

20-abx262904
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rab4a sgRNA CRISPR Lentivector set (Rat)

K6790901 3 x 1.0 ug
EUR 339

Rab4a sgRNA CRISPR Lentivector set (Mouse)

K3769901 3 x 1.0 ug
EUR 339

RAB4A sgRNA CRISPR Lentivector set (Human)

K1769201 3 x 1.0 ug
EUR 339

Anti-Rab4A/Rab4 Rabbit Monoclonal Antibody

M04643 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rab4A/Rab4 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05989 2µg Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05990 10µg Ask for price

Recombinant Human RAB4A, Member RAS Oncogene Family

7-05991 1mg Ask for price

Human Ras-related protein Rab-4A (RAB4A)

1-CSB-EP019211HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-4A(RAB4A) expressed in E.coli

Ras-Related Protein Rab-4A (RAB4A) Antibody

20-abx445146
  • EUR 467.00
  • EUR 314.00
  • 100 ul
  • 25 ul
  • Shipped within 5-12 working days.

Monoclonal RAB4A Antibody (monoclonal) (M01), Clone: 1C10

AMM03978G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAB4A (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C10. This antibody is applicable in WB, E

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6790902 1.0 ug DNA
EUR 154

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6790903 1.0 ug DNA
EUR 154

Rab4a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6790904 1.0 ug DNA
EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3769902 1.0 ug DNA
EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3769903 1.0 ug DNA
EUR 154

Rab4a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3769904 1.0 ug DNA
EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 1)

K1769202 1.0 ug DNA
EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 2)

K1769203 1.0 ug DNA
EUR 154

RAB4A sgRNA CRISPR Lentivector (Human) (Target 3)

K1769204 1.0 ug DNA
EUR 154

RAB4A Protein Vector (Rat) (pPB-C-His)

PV297822 500 ng
EUR 603

RAB4A Protein Vector (Rat) (pPB-N-His)

PV297823 500 ng
EUR 603

RAB4A Protein Vector (Rat) (pPM-C-HA)

PV297824 500 ng
EUR 603

RAB4A Protein Vector (Rat) (pPM-C-His)

PV297825 500 ng
EUR 603

RAB4A Protein Vector (Human) (pPB-C-His)

PV034037 500 ng
EUR 329

RAB4A Protein Vector (Human) (pPB-N-His)

PV034038 500 ng
EUR 329

RAB4A Protein Vector (Human) (pPM-C-HA)

PV034039 500 ng
EUR 329

RAB4A Protein Vector (Human) (pPM-C-His)

PV034040 500 ng
EUR 329

Back to top