RNF182

RNF182 Antibody

1-CSB-PA822714LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RNF182 antibody

70R-6667 50 ug
EUR 467
Description: Rabbit polyclonal RNF182 antibody raised against the N terminal of RNF182

RNF182 antibody

70R-6668 50 ug
EUR 467
Description: Rabbit polyclonal RNF182 antibody raised against the middle region of RNF182

RNF182 siRNA

20-abx904614
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF182 siRNA

20-abx931735
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF182 siRNA

20-abx931736
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RNF182

YF-PA26984 50 ul
EUR 334
Description: Mouse polyclonal to RNF182

E3 Ubiquitin-Protein Ligase RNF182 (RNF182) Antibody

20-abx308992
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF182 Blocking Peptide

33R-5457 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF182 antibody, catalog no. 70R-6668

RNF182 Blocking Peptide

33R-1741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF182 antibody, catalog no. 70R-6667

RNF182 Antibody (HRP)

20-abx308993
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF182 Antibody (FITC)

20-abx308994
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF182 Antibody (Biotin)

20-abx308995
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF182 cloning plasmid

CSB-CL822714HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggccagtcaacctcctgaagacactgcggagtctcaggcctctgatgagctggagtgcaaaatctgttacaatcgatacaatctgaaacagaggaaacccaaagtgctggagtgttgtcatagggtttgtgccaaatgcctctacaagatcatagactttggggactccccaca
  • Show more
Description: A cloning plasmid for the RNF182 gene.

RNF182 Polyclonal Antibody

A60642 100 µg
EUR 570.55
Description: fast delivery possible

Anti-RNF182 (2D8)

YF-MA20040 100 ug
EUR 363
Description: Mouse monoclonal to RNF182

Human E3 ubiquitin- protein ligase RNF182, RNF182 ELISA KIT

ELI-44963h 96 Tests
EUR 824

Mouse E3 ubiquitin- protein ligase RNF182, Rnf182 ELISA KIT

ELI-41157m 96 Tests
EUR 865

RNF182 Antibody, HRP conjugated

1-CSB-PA822714LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF182 Antibody, FITC conjugated

1-CSB-PA822714LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF182 Antibody, Biotin conjugated

1-CSB-PA822714LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RNF182 shRNA Plasmid

20-abx990876
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNF182 shRNA Plasmid

20-abx966530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RNF182 shRNA Plasmid

20-abx983514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNF182 Recombinant Protein (Human)

RP026635 100 ug Ask for price

RNF182 Recombinant Protein (Mouse)

RP168575 100 ug Ask for price

RNF182 Recombinant Protein (Rat)

RP226376 100 ug Ask for price

RNF182 Polyclonal Antibody, Biotin Conjugated

A60643 100 µg
EUR 570.55
Description: reagents widely cited

RNF182 Polyclonal Antibody, FITC Conjugated

A60644 100 µg
EUR 570.55
Description: Ask the seller for details

RNF182 Polyclonal Antibody, HRP Conjugated

A60645 100 µg
EUR 570.55
Description: The best epigenetics products

Rnf182 ORF Vector (Rat) (pORF)

ORF075460 1.0 ug DNA
EUR 506

RNF182 ORF Vector (Human) (pORF)

ORF008879 1.0 ug DNA
EUR 95

Rnf182 ORF Vector (Mouse) (pORF)

ORF056193 1.0 ug DNA
EUR 506

Rnf182 sgRNA CRISPR Lentivector set (Rat)

K6548901 3 x 1.0 ug
EUR 339

Rnf182 sgRNA CRISPR Lentivector set (Mouse)

K4305501 3 x 1.0 ug
EUR 339

RNF182 sgRNA CRISPR Lentivector set (Human)

K1840801 3 x 1.0 ug
EUR 339

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6548902 1.0 ug DNA
EUR 154

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6548903 1.0 ug DNA
EUR 154

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6548904 1.0 ug DNA
EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4305502 1.0 ug DNA
EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4305503 1.0 ug DNA
EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4305504 1.0 ug DNA
EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 1)

K1840802 1.0 ug DNA
EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 2)

K1840803 1.0 ug DNA
EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 3)

K1840804 1.0 ug DNA
EUR 154

RNF182 Protein Vector (Rat) (pPB-C-His)

PV301838 500 ng
EUR 603

RNF182 Protein Vector (Rat) (pPB-N-His)

PV301839 500 ng
EUR 603

RNF182 Protein Vector (Rat) (pPM-C-HA)

PV301840 500 ng
EUR 603

RNF182 Protein Vector (Rat) (pPM-C-His)

PV301841 500 ng
EUR 603

RNF182 Protein Vector (Human) (pPB-C-His)

PV035513 500 ng
EUR 329

RNF182 Protein Vector (Human) (pPB-N-His)

PV035514 500 ng
EUR 329

RNF182 Protein Vector (Human) (pPM-C-HA)

PV035515 500 ng
EUR 329

RNF182 Protein Vector (Human) (pPM-C-His)

PV035516 500 ng
EUR 329

RNF182 Protein Vector (Mouse) (pPB-C-His)

PV224770 500 ng
EUR 603

RNF182 Protein Vector (Mouse) (pPB-N-His)

PV224771 500 ng
EUR 603

RNF182 Protein Vector (Mouse) (pPM-C-HA)

PV224772 500 ng
EUR 603

RNF182 Protein Vector (Mouse) (pPM-C-His)

PV224773 500 ng
EUR 603

Rnf182 3'UTR Luciferase Stable Cell Line

TU117982 1.0 ml Ask for price

Rnf182 3'UTR GFP Stable Cell Line

TU167982 1.0 ml Ask for price

Rnf182 3'UTR Luciferase Stable Cell Line

TU219534 1.0 ml Ask for price

Rnf182 3'UTR GFP Stable Cell Line

TU269534 1.0 ml Ask for price

RNF182 3'UTR GFP Stable Cell Line

TU070092 1.0 ml
EUR 1521

RNF182 3'UTR Luciferase Stable Cell Line

TU020092 1.0 ml
EUR 1521

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV697279 1.0 ug DNA
EUR 514

RNF182 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV697283 1.0 ug DNA
EUR 514

RNF182 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV697284 1.0 ug DNA
EUR 514

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6548905 3 x 1.0 ug
EUR 376

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4305505 3 x 1.0 ug
EUR 376

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1840805 3 x 1.0 ug
EUR 376

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV697280 1.0 ug DNA
EUR 514

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV697281 1.0 ug DNA
EUR 572

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV697282 1.0 ug DNA
EUR 572

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6548906 1.0 ug DNA
EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6548907 1.0 ug DNA
EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6548908 1.0 ug DNA
EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4305506 1.0 ug DNA
EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4305507 1.0 ug DNA
EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4305508 1.0 ug DNA
EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1840806 1.0 ug DNA
EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1840807 1.0 ug DNA
EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1840808 1.0 ug DNA
EUR 167

Back to top