RNF182

RNF182 Antibody
1-CSB-PA822714LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RNF182 antibody
70R-6667	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RNF182 antibody raised against the N terminal of RNF182

RNF182 antibody
70R-6668	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RNF182 antibody raised against the middle region of RNF182

RNF182 siRNA
20-abx904614	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF182 siRNA
20-abx931735	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF182 siRNA
20-abx931736	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RNF182
YF-PA26984	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RNF182

E3 Ubiquitin-Protein Ligase RNF182 (RNF182) Antibody
20-abx308992	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF182 Blocking Peptide
33R-5457	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF182 antibody, catalog no. 70R-6668

RNF182 Blocking Peptide
33R-1741	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF182 antibody, catalog no. 70R-6667

RNF182 Antibody (HRP)
20-abx308993	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF182 Antibody (FITC)
20-abx308994	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF182 Antibody (Biotin)
20-abx308995	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RNF182 cloning plasmid
CSB-CL822714HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 744 Sequence: atggccagtcaacctcctgaagacactgcggagtctcaggcctctgatgagctggagtgcaaaatctgttacaatcgatacaatctgaaacagaggaaacccaaagtgctggagtgttgtcatagggtttgtgccaaatgcctctacaagatcatagactttggggactccccaca Show more
Description: A cloning plasmid for the RNF182 gene.

RNF182 Polyclonal Antibody
A60642	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-RNF182 (2D8)
YF-MA20040	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RNF182

Human E3 ubiquitin- protein ligase RNF182, RNF182 ELISA KIT
ELI-44963h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase RNF182, Rnf182 ELISA KIT
ELI-41157m	Lifescience Market	96 Tests	EUR 865

RNF182 Antibody, HRP conjugated
1-CSB-PA822714LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF182 Antibody, FITC conjugated
1-CSB-PA822714LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF182 Antibody, Biotin conjugated
1-CSB-PA822714LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat RNF182 shRNA Plasmid
20-abx990876	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RNF182 shRNA Plasmid
20-abx966530	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RNF182 shRNA Plasmid
20-abx983514	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNF182 Recombinant Protein (Human)
RP026635	ABM	100 ug	Ask for price

RNF182 Recombinant Protein (Mouse)
RP168575	ABM	100 ug	Ask for price

RNF182 Recombinant Protein (Rat)
RP226376	ABM	100 ug	Ask for price

RNF182 Polyclonal Antibody, Biotin Conjugated
A60643	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RNF182 Polyclonal Antibody, FITC Conjugated
A60644	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RNF182 Polyclonal Antibody, HRP Conjugated
A60645	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Rnf182 ORF Vector (Rat) (pORF)
ORF075460	ABM	1.0 ug DNA	EUR 506

RNF182 ORF Vector (Human) (pORF)
ORF008879	ABM	1.0 ug DNA	EUR 95

Rnf182 ORF Vector (Mouse) (pORF)
ORF056193	ABM	1.0 ug DNA	EUR 506

Rnf182 sgRNA CRISPR Lentivector set (Rat)
K6548901	ABM	3 x 1.0 ug	EUR 339

Rnf182 sgRNA CRISPR Lentivector set (Mouse)
K4305501	ABM	3 x 1.0 ug	EUR 339

RNF182 sgRNA CRISPR Lentivector set (Human)
K1840801	ABM	3 x 1.0 ug	EUR 339

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6548902	ABM	1.0 ug DNA	EUR 154

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6548903	ABM	1.0 ug DNA	EUR 154

Rnf182 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6548904	ABM	1.0 ug DNA	EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4305502	ABM	1.0 ug DNA	EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4305503	ABM	1.0 ug DNA	EUR 154

Rnf182 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4305504	ABM	1.0 ug DNA	EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 1)
K1840802	ABM	1.0 ug DNA	EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 2)
K1840803	ABM	1.0 ug DNA	EUR 154

RNF182 sgRNA CRISPR Lentivector (Human) (Target 3)
K1840804	ABM	1.0 ug DNA	EUR 154

RNF182 Protein Vector (Rat) (pPB-C-His)
PV301838	ABM	500 ng	EUR 603

RNF182 Protein Vector (Rat) (pPB-N-His)
PV301839	ABM	500 ng	EUR 603

RNF182 Protein Vector (Rat) (pPM-C-HA)
PV301840	ABM	500 ng	EUR 603

RNF182 Protein Vector (Rat) (pPM-C-His)
PV301841	ABM	500 ng	EUR 603

RNF182 Protein Vector (Human) (pPB-C-His)
PV035513	ABM	500 ng	EUR 329

RNF182 Protein Vector (Human) (pPB-N-His)
PV035514	ABM	500 ng	EUR 329

RNF182 Protein Vector (Human) (pPM-C-HA)
PV035515	ABM	500 ng	EUR 329

RNF182 Protein Vector (Human) (pPM-C-His)
PV035516	ABM	500 ng	EUR 329

RNF182 Protein Vector (Mouse) (pPB-C-His)
PV224770	ABM	500 ng	EUR 603

RNF182 Protein Vector (Mouse) (pPB-N-His)
PV224771	ABM	500 ng	EUR 603

RNF182 Protein Vector (Mouse) (pPM-C-HA)
PV224772	ABM	500 ng	EUR 603

RNF182 Protein Vector (Mouse) (pPM-C-His)
PV224773	ABM	500 ng	EUR 603

Rnf182 3'UTR Luciferase Stable Cell Line
TU117982	ABM	1.0 ml	Ask for price

Rnf182 3'UTR GFP Stable Cell Line
TU167982	ABM	1.0 ml	Ask for price

Rnf182 3'UTR Luciferase Stable Cell Line
TU219534	ABM	1.0 ml	Ask for price

Rnf182 3'UTR GFP Stable Cell Line
TU269534	ABM	1.0 ml	Ask for price

RNF182 3'UTR GFP Stable Cell Line
TU070092	ABM	1.0 ml	EUR 1521

RNF182 3'UTR Luciferase Stable Cell Line
TU020092	ABM	1.0 ml	EUR 1521

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV697279	ABM	1.0 ug DNA	EUR 514

RNF182 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV697283	ABM	1.0 ug DNA	EUR 514

RNF182 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV697284	ABM	1.0 ug DNA	EUR 514

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6548905	ABM	3 x 1.0 ug	EUR 376

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4305505	ABM	3 x 1.0 ug	EUR 376

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1840805	ABM	3 x 1.0 ug	EUR 376

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV697280	ABM	1.0 ug DNA	EUR 514

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV697281	ABM	1.0 ug DNA	EUR 572

RNF182 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV697282	ABM	1.0 ug DNA	EUR 572

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6548906	ABM	1.0 ug DNA	EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6548907	ABM	1.0 ug DNA	EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6548908	ABM	1.0 ug DNA	EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4305506	ABM	1.0 ug DNA	EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4305507	ABM	1.0 ug DNA	EUR 167

Rnf182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4305508	ABM	1.0 ug DNA	EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1840806	ABM	1.0 ug DNA	EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1840807	ABM	1.0 ug DNA	EUR 167

RNF182 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1840808	ABM	1.0 ug DNA	EUR 167