RPL17

RPL17 antibody

70R-19967 50 ul
EUR 435
Description: Rabbit polyclonal RPL17 antibody

RPL17 antibody

70R-15181 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody

RPL17 antibody

70R-15372 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody

RPL17 Antibody

1-CSB-PA003980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

RPL17 Antibody

DF3699 200ul
EUR 304
Description: RPL17 Antibody detects endogenous levels of total RPL17.

RPL17 antibody

70R-50338 100 ul
EUR 244
Description: Purified Polyclonal RPL17 antibody

RPL17 antibody

70R-33944 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody

RPL17 Antibody

1-CSB-PA02504A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL17 Antibody

1-CSB-PA02505A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL17 Antibody

1-CSB-PA020149GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL17 siRNA

20-abx931923
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL17 siRNA

20-abx931924
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL17 Antibody

ABD3699 100 ug
EUR 438

pOTB7-RPL17

PVT18264 2 ug
EUR 231

anti-RPL17

YF-PA14436 100 ug
EUR 403
Description: Rabbit polyclonal to RPL17

RPL17 Polyclonal Antibody

30681-100ul 100ul
EUR 252

RPL17 Polyclonal Antibody

30681-50ul 50ul
EUR 187

RPL17 antibody (HRP)

60R-1383 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (HRP)

RPL17 antibody (FITC)

60R-1384 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (FITC)

RPL17 antibody (biotin)

60R-1385 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (biotin)

RPL17 antibody (HRP)

60R-1933 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (HRP)

RPL17 antibody (FITC)

60R-1934 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (FITC)

RPL17 antibody (biotin)

60R-1935 100 ug
EUR 327
Description: Rabbit polyclonal RPL17 antibody (biotin)

RPL17 Blocking Peptide

DF3699-BP 1mg
EUR 195

RPL17 Blocking Peptide

20-abx063213
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPL17 cloning plasmid

CSB-CL020149HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atggttcgctattcacttgacccggagaaccccacgaaatcatgcaaatcaagaggttccaatcttcgtgttcactttaagaacactcgtgaaactgctcaggccatcaagggtatgcatatacgaaaagccacgaagtatctgaaagatgtcactttacagaaacagtgtgtacc
  • Show more
Description: A cloning plasmid for the RPL17 gene.

RPL17 cloning plasmid

CSB-CL020149HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atggttcgctattcacttgacccggagaaccccacgaaatcatgcaaatcaagaggttccaatcttcgtgttcactttaagaacactcgtgaaactgctcaggccatcaagggtatgcatatacgaaaagccacgaagtatctgaaagatgtcactttacagaaacagtgtgtacc
  • Show more
Description: A cloning plasmid for the RPL17 gene.

RPL17 Rabbit pAb

A5934-100ul 100 ul
EUR 308

RPL17 Rabbit pAb

A5934-200ul 200 ul
EUR 459

RPL17 Rabbit pAb

A5934-20ul 20 ul
EUR 183

RPL17 Rabbit pAb

A5934-50ul 50 ul
EUR 223

RPL17 Polyclonal Antibody

A51893 100 µg
EUR 570.55
Description: The best epigenetics products

RPL17 Polyclonal Antibody

A52704 100 µg
EUR 570.55
Description: The best epigenetics products

anti- RPL17 antibody

FNab07416 100µg
EUR 548.75
  • Immunogen: ribosomal protein L17
  • Uniprot ID: P18621
  • Gene ID: 6139
  • Research Area: Metabolism
Description: Antibody raised against RPL17

Anti-RPL17 antibody

PAab07416 100 ug
EUR 386

Anti-RPL17 antibody

STJ27730 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL23 because the encoded protein shares amino acid identity with ribosomal protein L23 from Halobacterium marismortui; however, its official symbol is RPL17. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream C18orf32 (chromosome 18 open reading frame 32) gene.

Anti-RPL17 antibody

STJ71304 100 µg
EUR 359

Anti-RPL17 (3G11)

YF-MA15240 100 ug
EUR 363
Description: Mouse monoclonal to RPL17

RPL17 ELISA KIT|Human

EF002574 96 Tests
EUR 689

Rat RPL17 shRNA Plasmid

20-abx988502
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL17 Polyclonal Conjugated Antibody

C30681 100ul
EUR 397

RPL17 Antibody, HRP conjugated

1-CSB-PA02504B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL17 Antibody, FITC conjugated

1-CSB-PA02504C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL17 Antibody, Biotin conjugated

1-CSB-PA02504D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL17 Antibody, HRP conjugated

1-CSB-PA02505B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL17 Antibody, FITC conjugated

1-CSB-PA02505C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL17 Antibody, Biotin conjugated

1-CSB-PA02505D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL17. Recognizes RPL17 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL17 shRNA Plasmid

20-abx954130
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL17 Recombinant Protein (Human)

RP026878 100 ug Ask for price

RPL17 Recombinant Protein (Human)

RP026881 100 ug Ask for price

RPL17 Recombinant Protein (Mouse)

RP168977 100 ug Ask for price

RPL17 Recombinant Protein (Rat)

RP226616 100 ug Ask for price

Ribosomal Protein L17 (RPL17) Antibody

20-abx008760
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

20-abx004550
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

20-abx115228
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

20-abx119097
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

abx034561-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

abx034561-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

abx237416-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L17 (RPL17) Antibody

20-abx329937
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody

abx431913-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

RPL17 Polyclonal Antibody, HRP Conjugated

A51894 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL17 Polyclonal Antibody, FITC Conjugated

A51895 100 µg
EUR 570.55
Description: fast delivery possible

RPL17 Polyclonal Antibody, Biotin Conjugated

A51896 100 µg
EUR 570.55
Description: reagents widely cited

RPL17 Polyclonal Antibody, Biotin Conjugated

A52701 100 µg
EUR 570.55
Description: Ask the seller for details

RPL17 Polyclonal Antibody, FITC Conjugated

A52702 100 µg
EUR 570.55
Description: The best epigenetics products

RPL17 Polyclonal Antibody, HRP Conjugated

A52703 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rpl17 ORF Vector (Rat) (pORF)

ORF075540 1.0 ug DNA
EUR 506

RPL17 ORF Vector (Human) (pORF)

ORF008960 1.0 ug DNA
EUR 95

RPL17 ORF Vector (Human) (pORF)

ORF008961 1.0 ug DNA
EUR 95

Rpl17 ORF Vector (Mouse) (pORF)

ORF056327 1.0 ug DNA
EUR 506

Anti-RPL17/Ribosomal Protein L17 Antibody

A06980 100ug/200ul
EUR 397
Description: Goat Polyclonal RPL17/Ribosomal Protein L17 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L17 (RPL17)

1-CSB-RP025044h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L17(RPL17) expressed in E.coli

60S Ribosomal Protein L17 (RPL17) Antibody

20-abx110476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

60S Ribosomal Protein L17 (RPL17) Antibody

20-abx110477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L17 (RPL17) Antibody Pair

abx117331-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Rpl17 sgRNA CRISPR Lentivector set (Rat)

K7374501 3 x 1.0 ug
EUR 339

Rpl17 sgRNA CRISPR Lentivector set (Mouse)

K4395301 3 x 1.0 ug
EUR 339

RPL17 sgRNA CRISPR Lentivector set (Human)

K1912301 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L17 (RPL17) ELISA Kit

abx382902-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl17 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7374502 1.0 ug DNA
EUR 154

Rpl17 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7374503 1.0 ug DNA
EUR 154

Rpl17 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7374504 1.0 ug DNA
EUR 154

Rpl17 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4395302 1.0 ug DNA
EUR 154

Rpl17 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4395303 1.0 ug DNA
EUR 154

Back to top