RPL28

RPL28 antibody

70R-19976 50 ul
EUR 435
Description: Rabbit polyclonal RPL28 antibody

RPL28 Antibody

47712-100ul 100ul
EUR 252

RPL28 Antibody

34352-100ul 100ul
EUR 252

RPL28 Antibody

34352-50ul 50ul
EUR 187

RPL28 Antibody

1-CSB-PA003984
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RPL28 Antibody

DF3705 200ul
EUR 304
Description: RPL28 Antibody detects endogenous levels of total RPL28.

RPL28 Antibody

CSB-PA294909-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL28 Antibody

CSB-PA294909-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL28 antibody

70R-50341 100 ul
EUR 244
Description: Purified Polyclonal RPL28 antibody

RPL28 antibody

70R-33950 100 ug
EUR 327
Description: Rabbit polyclonal RPL28 antibody

RPL28 Antibody

1-CSB-PA020217EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RPL28 Antibody

1-CSB-PA020217GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

RPL28 siRNA

20-abx931950
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL28 siRNA

20-abx931951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL28 Antibody

ABD3705 100 ug
EUR 438

RPL28 Blocking Peptide

DF3705-BP 1mg
EUR 195

RPL28 Blocking Peptide

20-abx063216
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPL28 Conjugated Antibody

C47712 100ul
EUR 397

RPL28 cloning plasmid

CSB-CL020217HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atgtctgcgcatctgcaatggatggtcgtgcggaactgctccagtttcctgatcaagaggaataagcagacctacagcactgagcccaataacttgaaggcccgcaattccttccgctacaacggactgattcaccgcaagactgtgggcgtggagccggcagccgacggcaaagg
  • Show more
Description: A cloning plasmid for the RPL28 gene.

RPL28 cloning plasmid

CSB-CL020217HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atgtctgcgcatctgcaatggatggtcgtgcggaactgctccagtttcctgatcaagaggaataagcagacctacagcactgagcccaataacttgaaggcccgcaattccttccgctacaacggactgattcaccgcaagactgtgggcgtggagccggcagccgacggcaaagg
  • Show more
Description: A cloning plasmid for the RPL28 gene.

RPL28 Polyclonal Antibody

A53812 100 µg
EUR 570.55
Description: Ask the seller for details

RPL28 Rabbit pAb

A15095-100ul 100 ul
EUR 308

RPL28 Rabbit pAb

A15095-200ul 200 ul
EUR 459

RPL28 Rabbit pAb

A15095-20ul 20 ul
EUR 183

RPL28 Rabbit pAb

A15095-50ul 50 ul
EUR 223

anti- RPL28 antibody

FNab07428 100µg
EUR 548.75
  • Immunogen: ribosomal protein L28
  • Uniprot ID: P46779
  • Gene ID: 6158
  • Research Area: Metabolism
Description: Antibody raised against RPL28

Anti-RPL28 antibody

PAab07428 100 ug
EUR 386

Anti-RPL28 antibody

STJ117289 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L28E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

RPL28 ELISA KIT|Human

EF002586 96 Tests
EUR 689

Mouse RPL28 shRNA Plasmid

20-abx972494
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL28 Antibody, HRP conjugated

1-CSB-PA020217EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL28 Antibody, FITC conjugated

1-CSB-PA020217EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL28 Antibody, Biotin conjugated

1-CSB-PA020217ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL28. Recognizes RPL28 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human RPL28 shRNA Plasmid

20-abx954143
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL28 Recombinant Protein (Human)

RP026941 100 ug Ask for price

RPL28 Recombinant Protein (Human)

RP026944 100 ug Ask for price

RPL28 Recombinant Protein (Mouse)

RP169019 100 ug Ask for price

RPL28 Recombinant Protein (Rat)

RP226655 100 ug Ask for price

Ribosomal Protein L28 (RPL28) Antibody

20-abx008757
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L28 (RPL28) Antibody

20-abx115237
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L28 (RPL28) Antibody

abx146442-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L28 (RPL28) Antibody

20-abx014120
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L28 (RPL28) Antibody

abx237428-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L28 (RPL28) Antibody

20-abx328668
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L28 (RPL28) Antibody

abx332719-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

RPL28 Polyclonal Antibody, Biotin Conjugated

A53809 100 µg
EUR 570.55
Description: reagents widely cited

RPL28 Polyclonal Antibody, FITC Conjugated

A53810 100 µg
EUR 570.55
Description: Ask the seller for details

RPL28 Polyclonal Antibody, HRP Conjugated

A53811 100 µg
EUR 570.55
Description: The best epigenetics products

Rpl28 ORF Vector (Rat) (pORF)

ORF075553 1.0 ug DNA
EUR 506

RPL28 ORF Vector (Human) (pORF)

ORF008981 1.0 ug DNA
EUR 95

RPL28 ORF Vector (Human) (pORF)

ORF008982 1.0 ug DNA
EUR 95

Rpl28 ORF Vector (Mouse) (pORF)

ORF056341 1.0 ug DNA
EUR 506

Anti-RPL28/Ribosomal Protein L28 Antibody

A10323 100ul
EUR 397
Description: Rabbit Polyclonal RPL28/Ribosomal Protein L28 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L28 (RPL28)

1-CSB-EP020217HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L28(RPL28) expressed in E.coli

60S Ribosomal Protein L28 (RPL28) Antibody

20-abx109470
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl28 sgRNA CRISPR Lentivector set (Rat)

K7009401 3 x 1.0 ug
EUR 339

Rpl28 sgRNA CRISPR Lentivector set (Mouse)

K4617001 3 x 1.0 ug
EUR 339

RPL28 sgRNA CRISPR Lentivector set (Human)

K1954501 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L28 (RPL28) ELISA Kit

abx382913-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl28 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7009402 1.0 ug DNA
EUR 154

Rpl28 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7009403 1.0 ug DNA
EUR 154

Rpl28 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7009404 1.0 ug DNA
EUR 154

Rpl28 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4617002 1.0 ug DNA
EUR 154

Rpl28 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4617003 1.0 ug DNA
EUR 154

Rpl28 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4617004 1.0 ug DNA
EUR 154

RPL28 sgRNA CRISPR Lentivector (Human) (Target 1)

K1954502 1.0 ug DNA
EUR 154

RPL28 sgRNA CRISPR Lentivector (Human) (Target 2)

K1954503 1.0 ug DNA
EUR 154

RPL28 sgRNA CRISPR Lentivector (Human) (Target 3)

K1954504 1.0 ug DNA
EUR 154

RPL28 Protein Vector (Rat) (pPB-C-His)

PV302210 500 ng
EUR 603

RPL28 Protein Vector (Rat) (pPB-N-His)

PV302211 500 ng
EUR 603

RPL28 Protein Vector (Rat) (pPM-C-HA)

PV302212 500 ng
EUR 603

RPL28 Protein Vector (Rat) (pPM-C-His)

PV302213 500 ng
EUR 603

RPL28 Protein Vector (Human) (pPB-C-His)

PV035921 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPB-N-His)

PV035922 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPM-C-HA)

PV035923 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPM-C-His)

PV035924 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPB-C-His)

PV035925 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPB-N-His)

PV035926 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPM-C-HA)

PV035927 500 ng
EUR 329

RPL28 Protein Vector (Human) (pPM-C-His)

PV035928 500 ng
EUR 329

RPL28 Protein Vector (Mouse) (pPB-C-His)

PV225362 500 ng
EUR 603

RPL28 Protein Vector (Mouse) (pPB-N-His)

PV225363 500 ng
EUR 603

RPL28 Protein Vector (Mouse) (pPM-C-HA)

PV225364 500 ng
EUR 603

RPL28 Protein Vector (Mouse) (pPM-C-His)

PV225365 500 ng
EUR 603

Rpl28 3'UTR Luciferase Stable Cell Line

TU118091 1.0 ml Ask for price

Back to top