RPL37A

RPL37A antibody

70R-19981 50 ul
EUR 435
Description: Rabbit polyclonal RPL37A antibody

RPL37A antibody

70R-3004 50 ug
EUR 467
Description: Rabbit polyclonal RPL37A antibody raised against the middle region of RPL37A

RPL37A Antibody

47907-100ul 100ul
EUR 252

RPL37A Antibody

1-CSB-PA040244
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL37A. Recognizes RPL37A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPL37A antibody

70R-33958 100 ug
EUR 327
Description: Rabbit polyclonal RPL37A antibody

RPL37A Antibody

1-CSB-PA020267GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL37A. Recognizes RPL37A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL37A siRNA

20-abx904666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL37A siRNA

20-abx931971
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL37A siRNA

20-abx931972
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RPL37A

YF-PA24614 50 ul
EUR 334
Description: Mouse polyclonal to RPL37A

Rpl37a-ps1/ Rat Rpl37a-ps1 ELISA Kit

ELI-18046r 96 Tests
EUR 886

RPL37A Blocking Peptide

33R-1703 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL37A antibody, catalog no. 70R-3004

RPL37A Blocking Peptide

20-abx161423
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPL37A Conjugated Antibody

C47907 100ul
EUR 397

RPL37A cloning plasmid

CSB-CL020267HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 279
  • Sequence: atggccaaacgtaccaagaaagtcgggatcgtcggtaaatacgggacccgctatggggcctccctccggaaaatggtgaagaaaattgaaatcagccagcacgccaagtacacttgctctttctgtggcaaaaccaagatgaagagacgagctgtggggatctggcactgtggttc
  • Show more
Description: A cloning plasmid for the RPL37A gene.

RPL37A cloning plasmid

CSB-CL020267HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 219
  • Sequence: atggccaaacgtaccaagaaagtcgggatcgtcggtaaatacgggacccgctatggggcctccctccggaaaatggtgaagaaaattgaaatcagccagcacgccaagtacacttgctctttctgtggcaaaaccaagatgaagagacgagctgtggggatctggcactgtggttc
  • Show more
Description: A cloning plasmid for the RPL37A gene.

RPL37A Rabbit pAb

A17977-100ul 100 ul
EUR 384

RPL37A Rabbit pAb

A17977-200ul 200 ul
EUR 554

RPL37A Rabbit pAb

A17977-20ul 20 ul
EUR 183

RPL37A Rabbit pAb

A17977-50ul 50 ul
EUR 265

anti- RPL37A antibody

FNab07436 100µg
EUR 548.75
  • Immunogen: ribosomal protein L37a
  • Uniprot ID: P61513
  • Gene ID: 6168
  • Research Area: Metabolism
Description: Antibody raised against RPL37A

Anti-RPL37A antibody

PAab07436 100 ug
EUR 386

pBluescriptR-RPL37A Plasmid

PVT17230 2 ug
EUR 325

Anti-RPL37A antibody

STJ119955 100 µl
EUR 393

RPL37A ELISA KIT|Human

EF002593 96 Tests
EUR 689

Rat RPL37A shRNA Plasmid

20-abx991260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL37A shRNA Plasmid

20-abx972498
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL37A shRNA Plasmid

20-abx954151
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL37A Recombinant Protein (Human)

RP026992 100 ug Ask for price

RPL37A Recombinant Protein (Human)

RP026995 100 ug Ask for price

RPL37A Recombinant Protein (Mouse)

RP169079 100 ug Ask for price

RPL37A Recombinant Protein (Rat)

RP226694 100 ug Ask for price

RPL37A Recombinant Protein (Rat)

RP226697 100 ug Ask for price

Ribosomal Protein L37A (RPL37A) Antibody

20-abx116898
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L37a (RPL37A) Antibody

20-abx121713
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L37a (RPL37A) Antibody

abx237436-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L37a (RPL37A) Antibody

20-abx326585
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl37a ORF Vector (Rat) (pORF)

ORF075566 1.0 ug DNA
EUR 506

Rpl37a ORF Vector (Rat) (pORF)

ORF075567 1.0 ug DNA
EUR 506

RPL37A ORF Vector (Human) (pORF)

ORF008998 1.0 ug DNA
EUR 95

RPL37A ORF Vector (Human) (pORF)

ORF008999 1.0 ug DNA
EUR 95

Rpl37a ORF Vector (Mouse) (pORF)

ORF056361 1.0 ug DNA
EUR 506

Anti-RPL37A/Ribosomal Protein L37A Antibody

A10125 100ul
EUR 397
Description: Rabbit Polyclonal RPL37A/Ribosomal Protein L37A Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Rpl37a sgRNA CRISPR Lentivector set (Mouse)

K4796401 3 x 1.0 ug
EUR 339

Rpl37a sgRNA CRISPR Lentivector set (Rat)

K7614101 3 x 1.0 ug
EUR 339

RPL37A sgRNA CRISPR Lentivector set (Human)

K1985801 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L37a (RPL37A) ELISA Kit

abx382920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl37a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4796402 1.0 ug DNA
EUR 154

Rpl37a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4796403 1.0 ug DNA
EUR 154

Rpl37a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4796404 1.0 ug DNA
EUR 154

Rpl37a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7614102 1.0 ug DNA
EUR 154

Rpl37a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7614103 1.0 ug DNA
EUR 154

Rpl37a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7614104 1.0 ug DNA
EUR 154

RPL37A sgRNA CRISPR Lentivector (Human) (Target 1)

K1985802 1.0 ug DNA
EUR 154

RPL37A sgRNA CRISPR Lentivector (Human) (Target 2)

K1985803 1.0 ug DNA
EUR 154

RPL37A sgRNA CRISPR Lentivector (Human) (Target 3)

K1985804 1.0 ug DNA
EUR 154

RPL37A Protein Vector (Rat) (pPB-C-His)

PV302262 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPB-N-His)

PV302263 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPM-C-HA)

PV302264 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPM-C-His)

PV302265 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPB-C-His)

PV302266 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPB-N-His)

PV302267 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPM-C-HA)

PV302268 500 ng
EUR 603

RPL37A Protein Vector (Rat) (pPM-C-His)

PV302269 500 ng
EUR 603

RPL37A Protein Vector (Mouse) (pPB-C-His)

PV225442 500 ng
EUR 603

RPL37A Protein Vector (Mouse) (pPB-N-His)

PV225443 500 ng
EUR 603

RPL37A Protein Vector (Mouse) (pPM-C-HA)

PV225444 500 ng
EUR 603

RPL37A Protein Vector (Mouse) (pPM-C-His)

PV225445 500 ng
EUR 603

RPL37A Protein Vector (Human) (pPB-C-His)

PV035989 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPB-N-His)

PV035990 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPM-C-HA)

PV035991 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPM-C-His)

PV035992 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPB-C-His)

PV035993 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPB-N-His)

PV035994 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPM-C-HA)

PV035995 500 ng
EUR 329

RPL37A Protein Vector (Human) (pPM-C-His)

PV035996 500 ng
EUR 329

Rpl37a 3'UTR Luciferase Stable Cell Line

TU118105 1.0 ml Ask for price

Rpl37a 3'UTR GFP Stable Cell Line

TU168105 1.0 ml Ask for price

Rpl37a 3'UTR Luciferase Stable Cell Line

TU219647 1.0 ml Ask for price

Rpl37a 3'UTR GFP Stable Cell Line

TU269647 1.0 ml Ask for price

RPL37A 3'UTR GFP Stable Cell Line

TU071537 1.0 ml
EUR 1521

RPL37A 3'UTR Luciferase Stable Cell Line

TU021537 1.0 ml
EUR 1521

Rabbit 60S ribosomal protein L37a(RPL37A) ELISA kit

E04R0460-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L37a(RPL37A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L37a(RPL37A) ELISA kit

E04R0460-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L37a(RPL37A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L37a(RPL37A) ELISA kit

E04R0460-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L37a(RPL37A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top