RPS29

RPS29 antibody
70R-20010 50 ul
EUR 435
Description: Rabbit polyclonal RPS29 antibody
RPS29 antibody
70R-1428 100 ug
EUR 377
Description: Rabbit polyclonal RPS29 antibody raised against the N terminal of RPS29
RPS29 Antibody
1-CSB-PA020432GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS29. Recognizes RPS29 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
RPS29 Antibody
1-CSB-PA020432LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS29. Recognizes RPS29 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
RPS29 siRNA
20-abx904706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS29 siRNA
20-abx932077
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS29 siRNA
20-abx932078
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-RPS29
YF-PA24634 50 ul
EUR 334
Description: Mouse polyclonal to RPS29
RPS29 Blocking Peptide
33R-10293 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS29 antibody, catalog no. 70R-1428
RPS29 cloning plasmid
CSB-CL020432HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 171
  • Sequence: atgggtcaccagcagctgtactggagccacccgcgaaaattcggccagggttctcgctcttgtcgtgtctgttcaaaccggcacggtctgatccggaaatatggcctcaatatgtgccgccagtgtttccgtcagtacgcgaaggatatcggtttcattaagttggactaa
Description: A cloning plasmid for the RPS29 gene.
RPS29 Polyclonal Antibody
A69687 100 ?g
EUR 628.55
Description: reagents widely cited
anti- RPS29 antibody
FNab07474 100µg
EUR 585
  • Immunogen: ribosomal protein S29
  • Uniprot ID: P62273
  • Gene ID: 6235
  • Research Area: Metabolism
Description: Antibody raised against RPS29
Anti-RPS29 antibody
PAab07474 100 ug
EUR 412
Anti-RPS29 (3G9)
YF-MA15282 100 ug
EUR 363
Description: Mouse monoclonal to RPS29
RPS29 ELISA KIT|Human
EF002630 96 Tests
EUR 689
Mouse RPS29 shRNA Plasmid
20-abx972517
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS29 shRNA Plasmid
20-abx984950
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS29 Antibody, HRP conjugated
1-CSB-PA020432LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS29. Recognizes RPS29 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS29 Antibody, FITC conjugated
1-CSB-PA020432LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS29. Recognizes RPS29 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS29 Antibody, Biotin conjugated
1-CSB-PA020432LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS29. Recognizes RPS29 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human RPS29 shRNA Plasmid
20-abx954198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS29 Recombinant Protein (Human)
RP027178 100 ug Ask for price
RPS29 Recombinant Protein (Mouse)
RP169256 100 ug Ask for price
RPS29 Recombinant Protein (Rat)
RP226847 100 ug Ask for price
Ribosomal Protein S29 (RPS29) Antibody
20-abx115265
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S29 (RPS29) Antibody
abx237474-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Ribosomal Protein S29 (RPS29) Antibody
20-abx333688
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS29 Polyclonal Antibody, HRP Conjugated
A69688 100 ?g
EUR 628.55
Description: Ask the seller for details
RPS29 Polyclonal Antibody, FITC Conjugated
A69689 100 ?g
EUR 628.55
Description: The best epigenetics products
RPS29 Polyclonal Antibody, Biotin Conjugated
A69690 100 ?g
EUR 628.55
Description: kits suitable for this type of research
Rps29 ORF Vector (Rat) (pORF)
ORF075617 1.0 ug DNA
EUR 506
RPS29 ORF Vector (Human) (pORF)
ORF009060 1.0 ug DNA
EUR 95
Rps29 ORF Vector (Mouse) (pORF)
ORF056420 1.0 ug DNA
EUR 506
Ribosomal Protein S29 (RPS29) Antibody (HRP)
20-abx334488
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S29 (RPS29) Antibody (FITC)
20-abx334489
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S29 (RPS29) Antibody (Biotin)
20-abx334490
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps29 sgRNA CRISPR Lentivector set (Mouse)
K4945201 3 x 1.0 ug
EUR 339
Rps29 sgRNA CRISPR Lentivector set (Rat)
K6764101 3 x 1.0 ug
EUR 339
RPS29 sgRNA CRISPR Lentivector set (Human)
K2060001 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S29 (RPS29) ELISA Kit
abx382954-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rps29 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4945202 1.0 ug DNA
EUR 154
Rps29 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4945203 1.0 ug DNA
EUR 154
Rps29 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4945204 1.0 ug DNA
EUR 154
Rps29 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6764102 1.0 ug DNA
EUR 154
Rps29 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6764103 1.0 ug DNA
EUR 154
Rps29 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6764104 1.0 ug DNA
EUR 154
RPS29 sgRNA CRISPR Lentivector (Human) (Target 1)
K2060002 1.0 ug DNA
EUR 154
RPS29 sgRNA CRISPR Lentivector (Human) (Target 2)
K2060003 1.0 ug DNA
EUR 154
RPS29 sgRNA CRISPR Lentivector (Human) (Target 3)
K2060004 1.0 ug DNA
EUR 154
RPS29 Protein Vector (Rat) (pPB-C-His)
PV302466 500 ng
EUR 603
RPS29 Protein Vector (Rat) (pPB-N-His)
PV302467 500 ng
EUR 603
RPS29 Protein Vector (Rat) (pPM-C-HA)
PV302468 500 ng
EUR 603
RPS29 Protein Vector (Rat) (pPM-C-His)
PV302469 500 ng
EUR 603
RPS29 Protein Vector (Mouse) (pPB-C-His)
PV225678 500 ng
EUR 603
RPS29 Protein Vector (Mouse) (pPB-N-His)
PV225679 500 ng
EUR 603
RPS29 Protein Vector (Mouse) (pPM-C-HA)
PV225680 500 ng
EUR 603
RPS29 Protein Vector (Mouse) (pPM-C-His)
PV225681 500 ng
EUR 603
RPS29 Protein Vector (Human) (pPB-C-His)
PV036237 500 ng
EUR 329
RPS29 Protein Vector (Human) (pPB-N-His)
PV036238 500 ng
EUR 329
RPS29 Protein Vector (Human) (pPM-C-HA)
PV036239 500 ng
EUR 329
RPS29 Protein Vector (Human) (pPM-C-His)
PV036240 500 ng
EUR 329
Rps29 3'UTR Luciferase Stable Cell Line
TU118156 1.0 ml Ask for price
Rps29 3'UTR GFP Stable Cell Line
TU168156 1.0 ml Ask for price
Rps29 3'UTR Luciferase Stable Cell Line
TU219699 1.0 ml Ask for price
Rps29 3'UTR GFP Stable Cell Line
TU269699 1.0 ml Ask for price
RPS29 3'UTR GFP Stable Cell Line
TU072281 1.0 ml
EUR 1394
RPS29 3'UTR Luciferase Stable Cell Line
TU022281 1.0 ml
EUR 1394
Rabbit 40S ribosomal protein S29(RPS29) ELISA kit
E04R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S29(RPS29) ELISA kit
E04R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S29(RPS29) ELISA kit
E04R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S29(RPS29) ELISA kit
E02R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S29(RPS29) ELISA kit
E02R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S29(RPS29) ELISA kit
E02R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S29(RPS29) ELISA kit
E03R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S29(RPS29) ELISA kit
E03R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S29(RPS29) ELISA kit
E03R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S29(RPS29) ELISA kit
E01R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S29(RPS29) ELISA kit
E01R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S29(RPS29) ELISA kit
E01R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S29(RPS29) ELISA kit
E06R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S29(RPS29) ELISA kit
E06R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S29(RPS29) ELISA kit
E06R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 40S ribosomal protein S29(RPS29) ELISA kit
E08R0144-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 40S ribosomal protein S29(RPS29) ELISA kit
E08R0144-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 40S ribosomal protein S29(RPS29) ELISA kit
E08R0144-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S29(RPS29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top