SFTPB

SFTPB antibody
70R-20215 50 ul
EUR 338
Description: Rabbit polyclonal SFTPB antibody
SFTPB Antibody
20-1937 100 ug
EUR 231
Description: Polyclonal SFTPB Antibody
SFTPB Antibody
1-CSB-PA004136
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
SFTPB Antibody
1-CSB-PA18055A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Sus scrofa. This antibody is Unconjugated. Tested in the following application: ELISA
SFTPB antibody
70R-5411 50 ug
EUR 467
Description: Rabbit polyclonal SFTPB antibody raised against the middle region of SFTPB
SFTPB Antibody
1-CSB-PA021173GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SFTPB siRNA
20-abx933130
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SFTPB siRNA
20-abx933131
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SFTPB Polyclonal Antibody
30048-100ul 100ul
EUR 252
SFTPB Polyclonal Antibody
30048-50ul 50ul
EUR 187
SFTPB Blocking Peptide
33R-7093 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFTPB antibody, catalog no. 70R-5411
SFTPB cloning plasmid
CSB-CL021173HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atggctgagtcacacctgctgcagtggctgctgctgctgctgcccacgctctgtggcccaggcactgctgcctggaccacctcatccttggcctgtgcccagggccctgagttctggtgccaaagcctggagcaagcattgcagtgcagagccctagggcattgcctacaggaag
  • Show more
Description: A cloning plasmid for the SFTPB gene.
SFTPB Polyclonal Antibody
A53476 100 µg
EUR 570.55
Description: The best epigenetics products
SFTPB Rabbit pAb
A18613-100ul 100 ul Ask for price
SFTPB Rabbit pAb
A18613-200ul 200 ul Ask for price
SFTPB Rabbit pAb
A18613-20ul 20 ul Ask for price
SFTPB Rabbit pAb
A18613-50ul 50 ul
EUR 384
SFTPB Rabbit pAb
A1748-100ul 100 ul
EUR 308
SFTPB Rabbit pAb
A1748-200ul 200 ul
EUR 459
SFTPB Rabbit pAb
A1748-20ul 20 ul
EUR 183
SFTPB Rabbit pAb
A1748-50ul 50 ul
EUR 223
anti- SFTPB antibody
FNab07797 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: surfactant protein B
  • Uniprot ID: P07988
  • Gene ID: 6439
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against SFTPB
Anti-SFTPB antibody
PAab07797 100 ug
EUR 412
Anti-SFTPB antibody
STJ11100554 50 µl
EUR 393
Description: NA
Anti-SFTPB antibody
STJ111112 100 µl
EUR 277
Description: This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.
SFTPB Antibody, HRP conjugated
1-CSB-PA18055B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Sus scrofa. This antibody is HRP conjugated. Tested in the following application: ELISA
SFTPB Antibody, FITC conjugated
1-CSB-PA18055C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Sus scrofa. This antibody is FITC conjugated. Tested in the following application: ELISA
SFTPB Antibody, Biotin conjugated
1-CSB-PA18055D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFTPB. Recognizes SFTPB from Sus scrofa. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SFTPB ELISA Kit
ELA-E1622h 96 Tests
EUR 824
Canine SFTPB ELISA KIT
ELI-05298d 96 Tests
EUR 928
Mouse Sftpb ELISA KIT
ELI-05299m 96 Tests
EUR 865
Bovine SFTPB ELISA KIT
ELI-05300b 96 Tests
EUR 928
Human SFTPB ELISA KIT
ELI-05303h 96 Tests
EUR 824
SFTPB ELISA KIT|Human
EF005977 96 Tests
EUR 689
Rat SFTPB shRNA Plasmid
20-abx987829
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SFTPB Polyclonal Conjugated Antibody
C30048 100ul
EUR 397
Human SFTPB shRNA Plasmid
20-abx954350
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SFTPB Recombinant Protein (Human)
RP028348 100 ug Ask for price
SFTPB Recombinant Protein (Rat)
RP228413 100 ug Ask for price
SFTPB Recombinant Protein (Mouse)
RP171404 100 ug Ask for price
Surfactant Protein B (SFTPB) Antibody
20-abx008723
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Surfactant Protein B (SFTPB) Antibody
20-abx115916
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Surfactant Protein B (SFTPB) Antibody
20-abx123736
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Surfactant Protein B (SFTPB) Antibody
abx028735-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Surfactant Protein B (SFTPB) Antibody
abx028735-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Surfactant Protein B (SFTPB) Antibody
abx237797-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Surfactant Protein B (SFTPB) Antibody
20-abx323473
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
SFTPB Polyclonal Antibody, Biotin Conjugated
A53473 100 µg
EUR 570.55
Description: Ask the seller for details
SFTPB Polyclonal Antibody, FITC Conjugated
A53474 100 µg
EUR 570.55
Description: The best epigenetics products
SFTPB Polyclonal Antibody, HRP Conjugated
A53475 100 µg
EUR 570.55
Description: kits suitable for this type of research
Sftpb ORF Vector (Rat) (pORF)
ORF076139 1.0 ug DNA
EUR 506
SFTPB ORF Vector (Human) (pORF)
ORF009450 1.0 ug DNA
EUR 95
Sftpb ORF Vector (Mouse) (pORF)
ORF057136 1.0 ug DNA
EUR 506
pECMV-Sftpb-m-FLAG Plasmid
PVT15142 2 ug
EUR 325
SFTPB ELISA Kit (Human) (OKAN05268)
OKAN05268 96 Wells
EUR 792
Description: Description of target: This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL
SFTPB ELISA Kit (Mouse) (OKAN05909)
OKAN05909 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL
SFTPB ELISA Kit (Rat) (OKCD02891)
OKCD02891 96 Wells
EUR 857
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL
SFTPB ELISA Kit (Mouse) (OKCD02905)
OKCD02905 96 Wells
EUR 818
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL
SFTPB ELISA Kit (Rabbit) (OKCA00942)
OKCA00942 96 Wells
EUR 917
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.46 ng/mL
SFTPB ELISA Kit (Rat) (OKCA00998)
OKCA00998 96 Wells
EUR 917
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 pg/mL
SFTPB ELISA Kit (Pig) (OKCA02511)
OKCA02511 96 Wells
EUR 930
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.12 ng/mL
SFTPB ELISA Kit (Human) (OKCD07528)
OKCD07528 96 Wells
EUR 936
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL
SFTPB ELISA Kit (Human) (OKEH01166)
OKEH01166 96 Wells
EUR 740
Description: Description of target: This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3 ng/mL
SFTPB ELISA Kit (Bovine) (OKEH01167)
OKEH01167 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.079 ng/mL
SFTPB ELISA Kit (Mouse) (OKEH07153)
OKEH07153 96 Wells
EUR 662
Description: Description of target: Pulmonary surfactant-associated proteins promote alveolar stability by lowering the surface tension at the air-liquid interface in the peripheral air spaces. SP-B increases the collapse pressure of palmitic acid to nearly 70 millinewtons per meter. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.406 ng/mL
SFTPB ELISA Kit (Pig) (OKEH08395)
OKEH08395 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.87 ng/mL
Anti-Prosurfactant Protein B/SFTPB Antibody
A03441-1 100ug/vial
EUR 294
Sftpb sgRNA CRISPR Lentivector set (Rat)
K6947101 3 x 1.0 ug
EUR 339
Sftpb sgRNA CRISPR Lentivector set (Mouse)
K4346201 3 x 1.0 ug
EUR 339
SFTPB sgRNA CRISPR Lentivector set (Human)
K2135201 3 x 1.0 ug
EUR 339
Human Pulmonary surfactant-associated protein B(SFTPB)
30-1983 50 ug
EUR 978
Description: Recombinant Human Pulmonary surfactant-associated protein B(SFTPB)   
Bovine Pulmonary surfactant-associated protein B (SFTPB)
1-CSB-EP021173BO1
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Pulmonary surfactant-associated protein B(SFTPB),partial expressed in E.coli
Human Pulmonary surfactant-associated protein B (SFTPB)
1-CSB-YP021173HU
  • EUR 620.00
  • EUR 381.00
  • EUR 1949.00
  • EUR 880.00
  • EUR 1332.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 8.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pulmonary surfactant-associated protein B(SFTPB) expressed in Yeast
Human Pulmonary surfactant-associated protein B (SFTPB)
1-CSB-BP021173HU
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pulmonary surfactant-associated protein B(SFTPB) expressed in Baculovirus
Human Pulmonary surfactant-associated protein B (SFTPB)
1-CSB-CF021173HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 24.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pulmonary surfactant-associated protein B(SFTPB) expressed in in vitro E.coli expression system
Sftpb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6947102 1.0 ug DNA
EUR 154
Sftpb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6947103 1.0 ug DNA
EUR 154
Sftpb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6947104 1.0 ug DNA
EUR 154
Sftpb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4346202 1.0 ug DNA
EUR 154
Sftpb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4346203 1.0 ug DNA
EUR 154
Sftpb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4346204 1.0 ug DNA
EUR 154
SFTPB sgRNA CRISPR Lentivector (Human) (Target 1)
K2135202 1.0 ug DNA
EUR 154
SFTPB sgRNA CRISPR Lentivector (Human) (Target 2)
K2135203 1.0 ug DNA
EUR 154
SFTPB sgRNA CRISPR Lentivector (Human) (Target 3)
K2135204 1.0 ug DNA
EUR 154
SFTPB Protein Vector (Rat) (pPB-C-His)
PV304554 500 ng
EUR 603

Back to top