SRP19

SRP19 antibody
39152-100ul 100ul
EUR 252
SRP19 Antibody
DF12753 200ul
EUR 304
Description: SRP19 Antibody detects endogenous levels of SRP19.
SRP19 antibody
70R-4850 50 ug
EUR 467
Description: Rabbit polyclonal SRP19 antibody raised against the middle region of SRP19
SRP19 Antibody
1-CSB-PA022674HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SRP19 Antibody
1-CSB-PA022674LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
SRP19 siRNA
20-abx935167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SRP19
YF-PA14774 50 ul
EUR 363
Description: Mouse polyclonal to SRP19
anti-SRP19
YF-PA14775 50 ug
EUR 363
Description: Mouse polyclonal to SRP19
anti-SRP19
YF-PA14776 100 ul
EUR 403
Description: Rabbit polyclonal to SRP19
anti-SRP19
YF-PA14777 100 ug
EUR 403
Description: Rabbit polyclonal to SRP19
SRP19 Blocking Peptide
33R-4826 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRP19 antibody, catalog no. 70R-1410
SRP19 Blocking Peptide
33R-1750 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRP19 antibody, catalog no. 70R-4850
SRP19 Blocking Peptide
DF12753-BP 1mg
EUR 195
SRP19 Conjugated Antibody
C39152 100ul
EUR 397
SRP19 cloning plasmid
CSB-CL022674HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 435
  • Sequence: atggcttgcactgccgcgcggtccccggccgaccaggacaggtttatttgtatctatcctgcttatttaaataataagaagaccatcgcagagggaaggcgaatccccataagtaaggctgttgaaaatcctacagctacagagattcaagatgtatgttcagcagttggacttaa
  • Show more
Description: A cloning plasmid for the SRP19 gene.
SRP19 Rabbit pAb
A6752-100ul 100 ul
EUR 308
SRP19 Rabbit pAb
A6752-200ul 200 ul
EUR 459
SRP19 Rabbit pAb
A6752-20ul 20 ul
EUR 183
SRP19 Rabbit pAb
A6752-50ul 50 ul
EUR 223
SRP19 Polyclonal Antibody
A63494 100 µg
EUR 570.55
Description: fast delivery possible
SRP19 Polyclonal Antibody
A54760 100 µg
EUR 570.55
Description: fast delivery possible
anti- SRP19 antibody
FNab08230 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: signal recognition particle 19kDa
  • Uniprot ID: P09132
  • Gene ID: 6728
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SRP19
Anti-SRP19 antibody
PAab08230 100 ug
EUR 386
Anti-SRP19 antibody
STJ28835 100 µl
EUR 277
SRP19 protein (His tag)
80R-2821 50 ug
EUR 327
Description: Purified recombinant SRP19 protein (His tag)
Mouse Srp19 ELISA KIT
ELI-18697m 96 Tests
EUR 865
Bovine SRP19 ELISA KIT
ELI-29457b 96 Tests
EUR 928
SRP19 ELISA KIT|Human
EF003234 96 Tests
EUR 689
Human SRP19 ELISA KIT
ELI-42500h 96 Tests
EUR 824
SRP19 Antibody, HRP conjugated
1-CSB-PA022674HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SRP19 Antibody, FITC conjugated
1-CSB-PA022674HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SRP19 Antibody, Biotin conjugated
1-CSB-PA022674HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SRP19 Antibody, HRP conjugated
1-CSB-PA022674LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SRP19 Antibody, FITC conjugated
1-CSB-PA022674LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SRP19 Antibody, Biotin conjugated
1-CSB-PA022674LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRP19. Recognizes SRP19 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SRP19 shRNA Plasmid
20-abx954595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SRP19 Recombinant Protein (Rat)
RP231056 100 ug Ask for price
SRP19 Recombinant Protein (Human)
RP030085 100 ug Ask for price
SRP19 Recombinant Protein (Mouse)
RP175427 100 ug Ask for price
Polyclonal SRP19 antibody - middle region
AMM07973G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRP19 - middle region. This antibody is tested and proven to work in the following applications:
SRP19 Polyclonal Antibody, HRP Conjugated
A63495 100 µg
EUR 570.55
Description: reagents widely cited
SRP19 Polyclonal Antibody, FITC Conjugated
A63496 100 µg
EUR 570.55
Description: Ask the seller for details
SRP19 Polyclonal Antibody, Biotin Conjugated
A63497 100 µg
EUR 570.55
Description: The best epigenetics products
SRP19 Polyclonal Antibody, Biotin Conjugated
A54757 100 µg
EUR 570.55
Description: kits suitable for this type of research
SRP19 Polyclonal Antibody, FITC Conjugated
A54758 100 µg
EUR 570.55
Description: fast delivery possible
SRP19 Polyclonal Antibody, HRP Conjugated
A54759 100 µg
EUR 570.55
Description: reagents widely cited
Srp19 ORF Vector (Rat) (pORF)
ORF077020 1.0 ug DNA
EUR 506
SRP19 ORF Vector (Human) (pORF)
ORF010029 1.0 ug DNA
EUR 95
Srp19 ORF Vector (Mouse) (pORF)
ORF058477 1.0 ug DNA
EUR 506
SRP19 ELISA Kit (Human) (OKEH07768)
OKEH07768 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34pg/mL
Signal Recognition Particle 19 (SRP19) Antibody
20-abx005178
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Recognition Particle 19 (SRP19) Antibody
abx145681-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Signal Recognition Particle 19 (SRP19) Antibody
20-abx141520
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Recognition Particle 19 (SRP19) Antibody
abx238230-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Signal Recognition Particle 19 (SRP19) Antibody
20-abx305424
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Srp19 sgRNA CRISPR Lentivector set (Mouse)
K4973901 3 x 1.0 ug
EUR 339
Srp19 sgRNA CRISPR Lentivector set (Rat)
K6305601 3 x 1.0 ug
EUR 339
SRP19 sgRNA CRISPR Lentivector set (Human)
K2286201 3 x 1.0 ug
EUR 339
Human Signal recognition particle 19KDA protein (SRP19)
1-CSB-EP022674HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Signal recognition particle 19KDA protein(SRP19) expressed in E.coli
Signal Recognition Particle 19 (SRP19) Antibody (HRP)
20-abx305425
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Recognition Particle 19 (SRP19) Antibody (FITC)
20-abx305426
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Recognition Particle 19 (SRP19) Antibody (Biotin)
20-abx305427
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Srp19 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4973902 1.0 ug DNA
EUR 154
Srp19 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4973903 1.0 ug DNA
EUR 154
Srp19 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4973904 1.0 ug DNA
EUR 154
Srp19 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6305602 1.0 ug DNA
EUR 154
Srp19 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6305603 1.0 ug DNA
EUR 154
Srp19 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6305604 1.0 ug DNA
EUR 154
SRP19 sgRNA CRISPR Lentivector (Human) (Target 1)
K2286202 1.0 ug DNA
EUR 154
SRP19 sgRNA CRISPR Lentivector (Human) (Target 2)
K2286203 1.0 ug DNA
EUR 154
SRP19 sgRNA CRISPR Lentivector (Human) (Target 3)
K2286204 1.0 ug DNA
EUR 154
SRP19 Protein Vector (Rat) (pPB-C-His)
PV308078 500 ng
EUR 603
SRP19 Protein Vector (Rat) (pPB-N-His)
PV308079 500 ng
EUR 603
SRP19 Protein Vector (Rat) (pPM-C-HA)
PV308080 500 ng
EUR 603
SRP19 Protein Vector (Rat) (pPM-C-His)
PV308081 500 ng
EUR 603
SRP19 Protein Vector (Human) (pPB-C-His)
PV040113 500 ng
EUR 329
SRP19 Protein Vector (Human) (pPB-N-His)
PV040114 500 ng
EUR 329
SRP19 Protein Vector (Human) (pPM-C-HA)
PV040115 500 ng
EUR 329
SRP19 Protein Vector (Human) (pPM-C-His)
PV040116 500 ng
EUR 329
SRP19 Protein Vector (Mouse) (pPB-C-His)
PV233906 500 ng
EUR 603
SRP19 Protein Vector (Mouse) (pPB-N-His)
PV233907 500 ng
EUR 603
SRP19 Protein Vector (Mouse) (pPM-C-HA)
PV233908 500 ng
EUR 603
SRP19 Protein Vector (Mouse) (pPM-C-His)
PV233909 500 ng
EUR 603
Srp19 3'UTR Luciferase Stable Cell Line
TU119691 1.0 ml Ask for price
Srp19 3'UTR GFP Stable Cell Line
TU169691 1.0 ml Ask for price

Back to top