SRPRB

SRPRB antibody
70R-1768 100 ug
EUR 377
Description: Rabbit polyclonal SRPRB antibody raised against the C terminal of SRPRB
SRPRB antibody
70R-20528 50 ul
EUR 435
Description: Rabbit polyclonal SRPRB antibody
SRPRB Antibody
40333-100ul 100ul
EUR 252
SRPRB Antibody
1-CSB-PA896911LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
SRPRB Antibody
1-CSB-PA507142
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100
SRPRB antibody
70R-6615 50 ug
EUR 467
Description: Rabbit polyclonal SRPRB antibody raised against the middle region of SRPRB
SRPRB Antibody
1-CSB-PA022687GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SRPRB siRNA
20-abx905281
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SRPRB siRNA
20-abx935183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SRPRB siRNA
20-abx935184
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SRPRB Rabbit pAb
A10591-100ul 100 ul
EUR 308
SRPRB Rabbit pAb
A10591-200ul 200 ul
EUR 459
SRPRB Rabbit pAb
A10591-20ul 20 ul
EUR 183
SRPRB Rabbit pAb
A10591-50ul 50 ul
EUR 223
SRPRB Blocking Peptide
33R-1415 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRPRB antibody, catalog no. 70R-1768
SRPRB Blocking Peptide
33R-7499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SRPRB antibody, catalog no. 70R-6615
SRPRB cloning plasmid
CSB-CL896911HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atggcttccgcggactcgcgccgggtggcagatggcggcggtgccgggggcaccttccagccctacctagacaccttgcggcaggagctgcagcagacggacccaacgctgttgtcagtagtggtggcggttcttgcggtgctgctgacgctagtcttctggaagttaatccggag
  • Show more
Description: A cloning plasmid for the SRPRB gene.
SRPRB Conjugated Antibody
C40333 100ul
EUR 397
SRPRB Polyclonal Antibody
A51421 100 µg
EUR 570.55
Description: reagents widely cited
anti- SRPRB antibody
FNab08239 100µg
EUR 548.75
  • Immunogen: signal recognition particle receptor, B subunit
  • Uniprot ID: Q9Y5M8
  • Gene ID: 58477
  • Research Area: Metabolism
Description: Antibody raised against SRPRB
Anti-SRPRB antibody
PAab08239 100 ug
EUR 386
Anti-SRPRB antibody
STJ112604 100 µl
EUR 277
Description: The protein encoded by this gene has similarity to mouse protein which is a subunit of the signal recognition particle receptor (SR). This subunit is a transmembrane GTPase belonging to the GTPase superfamily. It anchors alpha subunit, a peripheral membrane GTPase, to the ER membrane. SR is required for the cotranslational targeting of both secretory and membrane proteins to the ER membrane.
SRPRB Antibody, HRP conjugated
1-CSB-PA896911LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SRPRB Antibody, FITC conjugated
1-CSB-PA896911LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SRPRB Antibody, Biotin conjugated
1-CSB-PA896911LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRPRB. Recognizes SRPRB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SRPRB ELISA KIT|Human
EF003242 96 Tests
EUR 689
Mouse Srprb ELISA KIT
ELI-52682m 96 Tests
EUR 865
Rat SRPRB shRNA Plasmid
20-abx989089
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SRPRB shRNA Plasmid
20-abx972894
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SRPRB shRNA Plasmid
20-abx961710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SRPRB ELISA KIT
ELI-39492h 96 Tests
EUR 824
SRPRB Recombinant Protein (Rat)
RP231083 100 ug Ask for price
SRPRB Recombinant Protein (Human)
RP030118 100 ug Ask for price
SRPRB Recombinant Protein (Mouse)
RP175460 100 ug Ask for price
SRPRB Polyclonal Antibody, HRP Conjugated
A51422 100 µg
EUR 570.55
Description: Ask the seller for details
SRPRB Polyclonal Antibody, FITC Conjugated
A51423 100 µg
EUR 570.55
Description: The best epigenetics products
SRPRB Polyclonal Antibody, Biotin Conjugated
A51424 100 µg
EUR 570.55
Description: kits suitable for this type of research
Srprb ORF Vector (Rat) (pORF)
ORF077029 1.0 ug DNA
EUR 506
SRPRB ORF Vector (Human) (pORF)
ORF010040 1.0 ug DNA
EUR 95
Srprb ORF Vector (Mouse) (pORF)
ORF058488 1.0 ug DNA
EUR 506
SRP Receptor Beta Subunit (SRPRB) Antibody
20-abx126649
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody
abx145271-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody
abx028597-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody
abx028597-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody
abx238239-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody
20-abx312443
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Srprb sgRNA CRISPR Lentivector set (Rat)
K6678601 3 x 1.0 ug
EUR 339
Srprb sgRNA CRISPR Lentivector set (Mouse)
K3400301 3 x 1.0 ug
EUR 339
SRPRB sgRNA CRISPR Lentivector set (Human)
K2287301 3 x 1.0 ug
EUR 339
Signal Recognition Particle Receptor B (SRPRB) Antibody
20-abx214994
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Recognition Particle Receptor B (SRPRB) Antibody
20-abx130654
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Signal Recognition Particle Receptor B (SRPRB) Antibody
20-abx130655
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody (HRP)
20-abx312444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody (FITC)
20-abx312445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SRP Receptor Beta Subunit (SRPRB) Antibody (Biotin)
20-abx312446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Srprb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6678602 1.0 ug DNA
EUR 154
Srprb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6678603 1.0 ug DNA
EUR 154
Srprb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6678604 1.0 ug DNA
EUR 154
Srprb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3400302 1.0 ug DNA
EUR 154
Srprb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3400303 1.0 ug DNA
EUR 154
Srprb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3400304 1.0 ug DNA
EUR 154
SRPRB sgRNA CRISPR Lentivector (Human) (Target 1)
K2287302 1.0 ug DNA
EUR 154
SRPRB sgRNA CRISPR Lentivector (Human) (Target 2)
K2287303 1.0 ug DNA
EUR 154
SRPRB sgRNA CRISPR Lentivector (Human) (Target 3)
K2287304 1.0 ug DNA
EUR 154
SRPRB Protein Vector (Rat) (pPB-C-His)
PV308114 500 ng
EUR 603
SRPRB Protein Vector (Rat) (pPB-N-His)
PV308115 500 ng
EUR 603
SRPRB Protein Vector (Rat) (pPM-C-HA)
PV308116 500 ng
EUR 603
SRPRB Protein Vector (Rat) (pPM-C-His)
PV308117 500 ng
EUR 603
SRPRB Protein Vector (Human) (pPB-C-His)
PV040157 500 ng
EUR 329
SRPRB Protein Vector (Human) (pPB-N-His)
PV040158 500 ng
EUR 329
SRPRB Protein Vector (Human) (pPM-C-HA)
PV040159 500 ng
EUR 329
SRPRB Protein Vector (Human) (pPM-C-His)
PV040160 500 ng
EUR 329
SRPRB Protein Vector (Mouse) (pPB-C-His)
PV233950 500 ng
EUR 603
SRPRB Protein Vector (Mouse) (pPB-N-His)
PV233951 500 ng
EUR 603
SRPRB Protein Vector (Mouse) (pPM-C-HA)
PV233952 500 ng
EUR 603
SRPRB Protein Vector (Mouse) (pPM-C-His)
PV233953 500 ng
EUR 603
Recombinant Signal Recognition Particle Receptor B (SRPRB)
4-RPC870Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5M8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Signal Recognition Particle Receptor B expressed in: E.coli
Recombinant Signal Recognition Particle Receptor B (SRPRB)
4-RPC870Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P47758
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Signal Recognition Particle Receptor B expressed in: E.coli
Srprb 3'UTR Luciferase Stable Cell Line
TU119701 1.0 ml Ask for price
Srprb 3'UTR GFP Stable Cell Line
TU169701 1.0 ml Ask for price
Srprb 3'UTR Luciferase Stable Cell Line
TU221186 1.0 ml Ask for price
SRPRB 3'UTR GFP Stable Cell Line
TU074616 1.0 ml
EUR 1394
Srprb 3'UTR GFP Stable Cell Line
TU271186 1.0 ml Ask for price
SRPRB 3'UTR Luciferase Stable Cell Line
TU024616 1.0 ml
EUR 1394
Signal Recognition Particle Receptor, B Subunit (SRPRB) Antibody
20-abx115550
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Back to top