STT3A

STT3A Antibody
47709-100ul 100ul
EUR 252
STT3A Antibody
DF12757 200ul
EUR 304
Description: STT3A Antibody detects endogenous levels of STT3A.
STT3A Antibody
1-CSB-PA022885GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STT3A. Recognizes STT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
STT3A Antibody
1-CSB-PA022885LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STT3A. Recognizes STT3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:50-1:200
STT3A siRNA
20-abx935552
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STT3A siRNA
20-abx935553
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-STT3A
YF-PA24027 50 ul
EUR 334
Description: Mouse polyclonal to STT3A
STT3A Blocking Peptide
DF12757-BP 1mg
EUR 195
STT3A Conjugated Antibody
C47709 100ul
EUR 397
STT3A cloning plasmid
CSB-CL022885HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2118
  • Sequence: atgactaagtttggatttttgcgattgtcctatgagaagcaggacacacttttgaagcttctcattctgtcaatggctgctgtattatccttctccactcgtctgtttgctgtcctgagatttgaaagtgttatccatgagtttgatccgtactttaattatcggactaccaggt
  • Show more
Description: A cloning plasmid for the STT3A gene.
STT3A Polyclonal Antibody
A63520 100 µg
EUR 570.55
Description: fast delivery possible
anti- STT3A antibody
FNab08355 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: STT3, subunit of the oligosaccharyltransferase complex, homolog A
  • Uniprot ID: P46977
  • Gene ID: 3703
  • Research Area: Metabolism
Description: Antibody raised against STT3A
Anti-STT3A antibody
PAab08355 100 ug
EUR 386
Anti-STT3A (4D4)
YF-MA10495 100 ug
EUR 363
Description: Mouse monoclonal to STT3A
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (Stt3a) Antibody
20-abx115878
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody
abx145723-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody
abx238355-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody
20-abx302424
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody (HRP)
20-abx305457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody (FITC)
20-abx305458
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
STT3A, Catalytic Subunit of The Oligosaccharyltransferase Complex (STT3A) Antibody (Biotin)
20-abx305459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Stt3a ELISA KIT
ELI-18877m 96 Tests
EUR 865
Human STT3A ELISA KIT
ELI-29273h 96 Tests
EUR 824
STT3A ELISA KIT|Human
EF003332 96 Tests
EUR 689
Bovine STT3A ELISA KIT
ELI-46203b 96 Tests
EUR 928
STT3A Antibody, HRP conjugated
1-CSB-PA022885LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STT3A. Recognizes STT3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
STT3A Antibody, FITC conjugated
1-CSB-PA022885LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STT3A. Recognizes STT3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
STT3A Antibody, Biotin conjugated
1-CSB-PA022885LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STT3A. Recognizes STT3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human STT3A shRNA Plasmid
20-abx952491
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse STT3A shRNA Plasmid
20-abx971108
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STT3A Recombinant Protein (Rat)
RP231563 100 ug Ask for price
STT3A Recombinant Protein (Human)
RP030499 100 ug Ask for price
STT3A Recombinant Protein (Mouse)
RP176210 100 ug Ask for price
Human STT3A, Catalytic Subunit Of The Oligosaccharyltransferase Complex (STT3A) ELISA Kit
abx383544-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
STT3A Polyclonal Antibody, HRP Conjugated
A63521 100 µg
EUR 570.55
Description: reagents widely cited
STT3A Polyclonal Antibody, FITC Conjugated
A63522 100 µg
EUR 570.55
Description: Ask the seller for details
STT3A Polyclonal Antibody, Biotin Conjugated
A63523 100 µg
EUR 570.55
Description: The best epigenetics products
Stt3a ORF Vector (Rat) (pORF)
ORF077189 1.0 ug DNA
EUR 506
STT3A ORF Vector (Human) (pORF)
ORF010167 1.0 ug DNA
EUR 95
Stt3a ORF Vector (Mouse) (pORF)
ORF058738 1.0 ug DNA
EUR 506
Stt3a sgRNA CRISPR Lentivector set (Rat)
K7497001 3 x 1.0 ug
EUR 339
Stt3a sgRNA CRISPR Lentivector set (Mouse)
K4496801 3 x 1.0 ug
EUR 339
STT3A sgRNA CRISPR Lentivector set (Human)
K2307801 3 x 1.0 ug
EUR 339
Stt3a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7497002 1.0 ug DNA
EUR 154
Stt3a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7497003 1.0 ug DNA
EUR 154
Stt3a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7497004 1.0 ug DNA
EUR 154
Stt3a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4496802 1.0 ug DNA
EUR 154
Stt3a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4496803 1.0 ug DNA
EUR 154
Stt3a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4496804 1.0 ug DNA
EUR 154
STT3A sgRNA CRISPR Lentivector (Human) (Target 1)
K2307802 1.0 ug DNA
EUR 154
STT3A sgRNA CRISPR Lentivector (Human) (Target 2)
K2307803 1.0 ug DNA
EUR 154
STT3A sgRNA CRISPR Lentivector (Human) (Target 3)
K2307804 1.0 ug DNA
EUR 154
STT3A Protein Vector (Rat) (pPB-C-His)
PV308754 500 ng
EUR 1191
STT3A Protein Vector (Rat) (pPB-N-His)
PV308755 500 ng
EUR 1191
STT3A Protein Vector (Rat) (pPM-C-HA)
PV308756 500 ng
EUR 1191
STT3A Protein Vector (Rat) (pPM-C-His)
PV308757 500 ng
EUR 1191
STT3A Protein Vector (Human) (pPB-C-His)
PV040665 500 ng
EUR 329
STT3A Protein Vector (Human) (pPB-N-His)
PV040666 500 ng
EUR 329
STT3A Protein Vector (Human) (pPM-C-HA)
PV040667 500 ng
EUR 329
STT3A Protein Vector (Human) (pPM-C-His)
PV040668 500 ng
EUR 329
STT3A Protein Vector (Mouse) (pPB-C-His)
PV234950 500 ng
EUR 1065
STT3A Protein Vector (Mouse) (pPB-N-His)
PV234951 500 ng
EUR 1065
STT3A Protein Vector (Mouse) (pPM-C-HA)
PV234952 500 ng
EUR 1065
STT3A Protein Vector (Mouse) (pPM-C-His)
PV234953 500 ng
EUR 1065
Stt3a 3'UTR Luciferase Stable Cell Line
TU119885 1.0 ml Ask for price
Stt3a 3'UTR GFP Stable Cell Line
TU169885 1.0 ml Ask for price
Stt3a 3'UTR Luciferase Stable Cell Line
TU221350 1.0 ml Ask for price
STT3A 3'UTR GFP Stable Cell Line
TU074861 1.0 ml
EUR 1394
Stt3a 3'UTR GFP Stable Cell Line
TU271350 1.0 ml Ask for price
STT3A 3'UTR Luciferase Stable Cell Line
TU024861 1.0 ml
EUR 1394
STT3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV638251 1.0 ug DNA
EUR 1355
STT3A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV638255 1.0 ug DNA
EUR 1355
STT3A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV638256 1.0 ug DNA
EUR 1355
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7497005 3 x 1.0 ug
EUR 376
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4496805 3 x 1.0 ug
EUR 376
STT3A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2307805 3 x 1.0 ug
EUR 376
STT3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV638252 1.0 ug DNA
EUR 1355
STT3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV638253 1.0 ug DNA
EUR 1413
STT3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV638254 1.0 ug DNA
EUR 1413
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7497006 1.0 ug DNA
EUR 167
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7497007 1.0 ug DNA
EUR 167
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7497008 1.0 ug DNA
EUR 167
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4496806 1.0 ug DNA
EUR 167
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4496807 1.0 ug DNA
EUR 167
Stt3a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4496808 1.0 ug DNA
EUR 167

Back to top