Tbp

TBP antibody
70R-31629 100 ug
EUR 327
Description: Rabbit polyclonal TBP antibody
TBP antibody
70R-14073 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal TBP antibody
TBP Antibody
33709-100ul 100ul
EUR 252
TBP Antibody
33709-50ul 50ul
EUR 187
TBP antibody
38396-100ul 100ul
EUR 252
TBP antibody
10R-1278 100 ug
EUR 512
Description: Mouse monoclonal TBP antibody
TBP Antibody
43335-100ul 100ul
EUR 252
TBP Antibody
1-CSB-PA004265
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000
TBP Antibody
1-CSB-PA080259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200
TBP Antibody
DF3115 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.
TBP Antibody
DF6915 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.
TBP Antibody
CSB-PA276652-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TBP Antibody
CSB-PA276652-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TBP Antibody
AF5476 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.
TBP Antibody
1-CSB-PA023239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TBP Antibody
1-CSB-PA023239HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TBP siRNA
20-abx936244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBP siRNA
20-abx936245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBP Antibody
ABF5476 100 ug
EUR 438
TBP Antibody
ABD3115 100 ug
EUR 438
TBP Antibody
ABD6915 100 ug
EUR 438
TBP Rabbit pAb
A1423-100ul 100 ul
EUR 308
TBP Rabbit pAb
A1423-200ul 200 ul
EUR 459
TBP Rabbit pAb
A1423-20ul 20 ul Ask for price
TBP Rabbit pAb
A1423-50ul 50 ul Ask for price
TBP Blocking Peptide
DF3115-BP 1mg
EUR 195
TBP Blocking Peptide
DF6915-BP 1mg
EUR 195
TBP Polyclonal Antibody
EA246-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBP from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TBP Polyclonal Antibody
EA246-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBP from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC
TBP Blocking Peptide
AF5476-BP 1mg
EUR 195
Monoclonal TBP Antibody
APR13717G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human TBP. The antibodies are raised in Mouse. This antibody is applicable in WB
TBP Conjugated Antibody
C43335 100ul
EUR 397
TBP Conjugated Antibody
C33709 100ul
EUR 397
TBP cloning plasmid
CSB-CL023239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: ATGGATCAGAACAACAGCCTGCCACCTTACGCTCAGGGCTTGGCCTCCCCTCAGGGTGCCATGACTCCCGGAATCCCTATCTTTAGTCCAATGATGCCTTATGGCACTGGACTGACCCCACAGCCTATTCAGAACACCAATAGTCTGTCTATTTTGGAAGAGCAACAAAGGCAGGC
  • Show more
Description: A cloning plasmid for the TBP gene.
TBP Rabbit pAb
A16436-100ul 100 ul
EUR 308
TBP Rabbit pAb
A16436-200ul 200 ul
EUR 459
TBP Rabbit pAb
A16436-20ul 20 ul
EUR 183
TBP Rabbit pAb
A16436-50ul 50 ul
EUR 223
TBP Polyclonal Antibody
ABP57276-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TBP Polyclonal Antibody
ABP57276-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TBP Polyclonal Antibody
ABP57276-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
anti- TBP antibody
FNab08525 100µg
EUR 548.75
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP
anti- TBP antibody
FNab08526 100µg
EUR 548.75
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP
anti- TBP antibody
FNab08527 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:5000
  • IP: 1:500-1:1000
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP
TBP Polyclonal Antibody
ES8275-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
TBP Polyclonal Antibody
ES8275-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
Anti-TBP antibody
PAab08525 100 ug
EUR 386
Anti-TBP antibody
PAab08526 100 ug
EUR 386
Recombinant Human TBP
P0268 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P20226
Description: Recombinant Human protein for TBP
Anti-TBP antibody
STJ25783 100 µl
EUR 277
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene.
Anti-TBP antibody
STJ25784 100 µl
EUR 413
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene.
Anti-TBP antibody
STJ118876 100 µl
EUR 277
Anti-TBP antibody
STJ97481 200 µl
EUR 197
Description: Rabbit polyclonal to TBP.
Anti-TBP/Tata Binding Protein Tbp Rabbit Monoclonal Antibody
M00302 100ug/vial
EUR 397
Description: Rabbit Monoclonal TBP/Tata Binding Protein Tbp Antibody. Validated in WB and tested in Human, Mouse, Rat.
Tbp-Like 1 Antibody
20-abx116011
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human TBP ELISA Kit
EHT0104 96Tests
EUR 521
Bovine TBP ELISA Kit
EBT0104 96Tests
EUR 521
Anserini TBP ELISA Kit
EAT0104 96Tests
EUR 521
Canine TBP ELISA Kit
ECT0104 96Tests
EUR 521
Goat TBP ELISA Kit
EGTT0104 96Tests
EUR 521
Anti-TBP Antibody (Monoclonal)
CI1132 100ul
EUR 491
Description: Mouse Monoclonal TBP Antibody (Monoclonal). Validated in ChIP, ChIP-qPCR, ChIP-seq, IHC and tested in Human, Mouse.
Mouse TBP shRNA Plasmid
20-abx973000
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal TBP Antibody (Center)
APR13719G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBP (Center). This antibody is tested and proven to work in the following applications:
Monoclonal TBP monoclonal antibody
APR13720G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TBP monoclonal. The antibodies are raised in Mouse. This antibody is applicable in WB
TBP Antibody, HRP conjugated
1-CSB-PA023239HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBP Antibody, FITC conjugated
1-CSB-PA023239HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBP Antibody, Biotin conjugated
1-CSB-PA023239HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TBP-Like 1 Protein
20-abx262864
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human TBP shRNA Plasmid
20-abx954734
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Porcine TBP ELISA Kit
EPT0104 96Tests
EUR 521
Rat TBP ELISA Kit
ERT0104 96Tests
EUR 521
Rabbit TBP ELISA Kit
ERTT0104 96Tests
EUR 521
Mouse TBP ELISA Kit
EMT0104 96Tests
EUR 521
TBP Recombinant Protein (Rat)
RP232490 100 ug Ask for price
TBP Recombinant Protein (Human)
RP044011 100 ug Ask for price

Back to top