Cullin 1 human protein and gene

TNIP3

TNIP3 Antibody
DF9083 200ul
EUR 304
Description: TNIP3 Antibody detects endogenous levels of total TNIP3.
TNIP3 Antibody
1-CSB-PA197029
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNIP3. Recognizes TNIP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
TNIP3 siRNA
20-abx937651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNIP3 Antibody
ABD9083 100 ug
EUR 438
TNIP3 Blocking Peptide
DF9083-BP 1mg
EUR 195
TNIP3 Conjugated Antibody
C37076 100ul
EUR 397
TNIP3 cloning plasmid
CSB-CL836243HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Sequence: ATGGCACATTTTGTACAGGGCACATCTAGAATGATTGCCGCAGAAAGTTCTACGGAGCATAAAGAGTGTGCTGAACCATCAACAAGAAAGAACTTGATGAATTCTCTTGAACAAAAGATAAGGTGTTTGGAAAAACAAAGAAAAGAGCTCCTGGAAGTTAACCAGCAATGGGATCA
  • Show more
Description: A cloning plasmid for the TNIP3 gene.
TNIP3 Polyclonal Antibody
ABP60717-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TNIP3 from Human. This TNIP3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
TNIP3 Polyclonal Antibody
ABP60717-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TNIP3 from Human. This TNIP3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
TNIP3 Polyclonal Antibody
ABP60717-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of TNIP3 from Human. This TNIP3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNIP3 protein at amino acid sequence of 40-120
TNIP3 Polyclonal Antibody
ES9279-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TNIP3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
TNIP3 Polyclonal Antibody
ES9279-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNIP3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-TNIP3 antibody
STJ190437 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNIP3
Human TNIP3 shRNA Plasmid
20-abx962673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNIP3 Recombinant Protein (Human)
RP044368 100 ug Ask for price
TNIP3 Recombinant Protein (Mouse)
RP180329 100 ug Ask for price
Polyclonal TNIP3 Antibody (C-Terminus)
APR02706G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNIP3 (C-Terminus). This antibody is tested and proven to work in the following applications:
TNIP3 ORF Vector (Human) (pORF)
ORF014790 1.0 ug DNA
EUR 354
Tnip3 ORF Vector (Mouse) (pORF)
ORF060111 1.0 ug DNA
EUR 506
TNIP3 ELISA Kit (Human) (OKCA01547)
OKCA01547 96 Wells
EUR 846
Description: Description of target: Binds to zinc finger protein TNFAIP3 and inhibits NF-kappa-B activation induced by tumor necrosis factor, Toll-like receptor 4 (TLR4), interleukin-1 and 12-O-tetradecanoylphorbol-13-acetate. Overexpression inhibits NF-kappa-B-dependent gene expression in response to lipopolysaccharide at a level downstream of TRAF6 and upstream of IKBKB. NF-kappa-B inhibition is independent of TNFAIP3 binding.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL
Polyclonal TNIP3 Antibody - N-terminal region
APR01625G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNIP3 - N-terminal region. This antibody is tested and proven to work in the following applications:
TNFAIP3 Interacting Protein 3 (TNIP3) Antibody
20-abx212129
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3 Interacting Protein 3 (TNIP3) Antibody
abx145428-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tnip3 sgRNA CRISPR Lentivector set (Mouse)
K4303401 3 x 1.0 ug
EUR 339
TNIP3 sgRNA CRISPR Lentivector set (Human)
K2418401 3 x 1.0 ug
EUR 339
Tnip3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4303402 1.0 ug DNA
EUR 154
Tnip3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4303403 1.0 ug DNA
EUR 154
Tnip3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4303404 1.0 ug DNA
EUR 154
TNIP3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2418402 1.0 ug DNA
EUR 154
TNIP3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2418403 1.0 ug DNA
EUR 154
TNIP3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2418404 1.0 ug DNA
EUR 154
TNIP3 Protein Vector (Human) (pPB-C-His)
PV059157 500 ng
EUR 481
TNIP3 Protein Vector (Human) (pPB-N-His)
PV059158 500 ng
EUR 481
TNIP3 Protein Vector (Human) (pPM-C-HA)
PV059159 500 ng
EUR 481
TNIP3 Protein Vector (Human) (pPM-C-His)
PV059160 500 ng
EUR 481
TNIP3 Protein Vector (Mouse) (pPB-C-His)
PV240442 500 ng
EUR 603
TNIP3 Protein Vector (Mouse) (pPB-N-His)
PV240443 500 ng
EUR 603
TNIP3 Protein Vector (Mouse) (pPM-C-HA)
PV240444 500 ng
EUR 603
TNIP3 Protein Vector (Mouse) (pPM-C-His)
PV240445 500 ng
EUR 603
Tnip3 3'UTR Luciferase Stable Cell Line
TU120908 1.0 ml Ask for price
Tnip3 3'UTR GFP Stable Cell Line
TU170908 1.0 ml Ask for price
TNIP3 3'UTR GFP Stable Cell Line
TU076046 1.0 ml
EUR 1394
TNIP3 3'UTR Luciferase Stable Cell Line
TU026046 1.0 ml
EUR 1394
Human TNFAIP3- interacting protein 3, TNIP3 ELISA KIT
ELI-39852h 96 Tests
EUR 824
ELISA kit for Human TNFAIP3-interacting protein 3 (TNIP3)
KTE60197-48T 48T
EUR 332
  • Using differential display RT-PCR, followed by 5-prime and 3-prime RACE, Staege et al. (2001) isolated a cDNA encoding TNIP3, which they called LIND, that was upregulated in monocytes infected with Listeria monocytogenes. The predicted 325-amino acid
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 3 (TNIP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human TNFAIP3-interacting protein 3 (TNIP3)
KTE60197-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Using differential display RT-PCR, followed by 5-prime and 3-prime RACE, Staege et al. (2001) isolated a cDNA encoding TNIP3, which they called LIND, that was upregulated in monocytes infected with Listeria monocytogenes. The predicted 325-amino acid
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 3 (TNIP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human TNFAIP3-interacting protein 3 (TNIP3)
KTE60197-96T 96T
EUR 539
  • Using differential display RT-PCR, followed by 5-prime and 3-prime RACE, Staege et al. (2001) isolated a cDNA encoding TNIP3, which they called LIND, that was upregulated in monocytes infected with Listeria monocytogenes. The predicted 325-amino acid
  • Show more
Description: Quantitative sandwich ELISA for measuring Human TNFAIP3-interacting protein 3 (TNIP3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Tnip3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4303405 3 x 1.0 ug
EUR 376
TNIP3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2418405 3 x 1.0 ug
EUR 376
Tnip3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4303406 1.0 ug DNA
EUR 167
Tnip3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4303407 1.0 ug DNA
EUR 167
Tnip3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4303408 1.0 ug DNA
EUR 167
TNIP3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2418406 1.0 ug DNA
EUR 167
TNIP3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2418407 1.0 ug DNA
EUR 167
TNIP3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2418408 1.0 ug DNA
EUR 167

Back to top