  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TOMM7 Polyclonal Antibody
30141-100ul 100ul
EUR 252
TOMM7 Polyclonal Antibody
30141-50ul 50ul
EUR 187
TOMM7 cloning plasmid
CSB-CL889171HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 168
  • Sequence: atggtgaagctgagcaaagaggccaagcagagactacagcagctcttcaaggggagccagtttgccattcgctggggctttatccctcttgtgatttacctgggatttaagaggggtgcagatcccggaatgcctgaaccaactgttttgagcctactttggggataa
Description: A cloning plasmid for the TOMM7 gene.
TOMM7 Rabbit pAb
A17711-100ul 100 ul
EUR 308
TOMM7 Rabbit pAb
A17711-200ul 200 ul
EUR 459
TOMM7 Rabbit pAb
A17711-20ul 20 ul
EUR 183
TOMM7 Rabbit pAb
A17711-50ul 50 ul
EUR 223
anti- TOMM7 antibody
FNab08864 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: translocase of outer mitochondrial membrane 7 homolog(yeast)
  • Uniprot ID: Q9P0U1
  • Gene ID: 54543
  • Research Area: Signal Transduction
Description: Antibody raised against TOMM7
Anti-TOMM7 antibody
PAab08864 100 ug
EUR 386
Anti-TOMM7 antibody
STJ119752 100 µl
EUR 277
Description: This gene encodes a subunit of the translocase of the outer mitochondrial membrane. The encoded protein regulates the assembly and stability of the translocase complex. [provided by RefSeq, Oct 2012]
Anti-TOMM7 Antibody
STJ503354 100 µg
EUR 476
Mouse Tomm7 ELISA KIT
ELI-17140m 96 Tests
EUR 865
ELI-23057b 96 Tests
EUR 928
EF003745 96 Tests
EUR 689
Mouse TOMM7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TOMM7 Polyclonal Conjugated Antibody
C30141 100ul
EUR 397
Human TOMM7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-40014h 96 Tests
EUR 824
TOMM7 Recombinant Protein (Rat)
RP234233 100 ug Ask for price
TOMM7 Recombinant Protein (Human)
RP032560 100 ug Ask for price
TOMM7 Recombinant Protein (Mouse)
RP180551 100 ug Ask for price
Anti-TOMM7 Antibody (Biotin)
STJ503355 100 µg
EUR 586
Anti-TOMM7 Antibody (FITC)
STJ503356 100 µg
EUR 586
Tomm7 ORF Vector (Rat) (pORF)
ORF078079 1.0 ug DNA
EUR 506
TOMM7 ORF Vector (Human) (pORF)
ORF010854 1.0 ug DNA
EUR 95
Tomm7 ORF Vector (Mouse) (pORF)
ORF060185 1.0 ug DNA
EUR 506
Tomm7 sgRNA CRISPR Lentivector set (Rat)
K6054801 3 x 1.0 ug
EUR 339
Tomm7 sgRNA CRISPR Lentivector set (Mouse)
K3047801 3 x 1.0 ug
EUR 339
TOMM7 sgRNA CRISPR Lentivector set (Human)
K2423201 3 x 1.0 ug
EUR 339
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6054802 1.0 ug DNA
EUR 154
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6054803 1.0 ug DNA
EUR 154
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6054804 1.0 ug DNA
EUR 154
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3047802 1.0 ug DNA
EUR 154
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3047803 1.0 ug DNA
EUR 154
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3047804 1.0 ug DNA
EUR 154
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2423202 1.0 ug DNA
EUR 154
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2423203 1.0 ug DNA
EUR 154
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2423204 1.0 ug DNA
EUR 154
TOMM7 Protein Vector (Rat) (pPB-C-His)
PV312314 500 ng
EUR 603
TOMM7 Protein Vector (Rat) (pPB-N-His)
PV312315 500 ng
EUR 603
TOMM7 Protein Vector (Rat) (pPM-C-HA)
PV312316 500 ng
EUR 603
TOMM7 Protein Vector (Rat) (pPM-C-His)
PV312317 500 ng
EUR 603
TOMM7 Protein Vector (Mouse) (pPB-C-His)
PV240738 500 ng
EUR 603
TOMM7 Protein Vector (Mouse) (pPB-N-His)
PV240739 500 ng
EUR 603
TOMM7 Protein Vector (Mouse) (pPM-C-HA)
PV240740 500 ng
EUR 603
TOMM7 Protein Vector (Mouse) (pPM-C-His)
PV240741 500 ng
EUR 603
TOMM7 Protein Vector (Human) (pPB-C-His)
PV043413 500 ng
EUR 329
TOMM7 Protein Vector (Human) (pPB-N-His)
PV043414 500 ng
EUR 329
TOMM7 Protein Vector (Human) (pPM-C-HA)
PV043415 500 ng
EUR 329
TOMM7 Protein Vector (Human) (pPM-C-His)
PV043416 500 ng
EUR 329
Tomm7 3'UTR Luciferase Stable Cell Line
TU120954 1.0 ml Ask for price
Tomm7 3'UTR GFP Stable Cell Line
TU170954 1.0 ml Ask for price
Tomm7 3'UTR Luciferase Stable Cell Line
TU222301 1.0 ml Ask for price
TOMM7 3'UTR GFP Stable Cell Line
TU076093 1.0 ml
EUR 1394
TOMM7 3'UTR Luciferase Stable Cell Line
TU026093 1.0 ml
EUR 1394
Tomm7 3'UTR GFP Stable Cell Line
TU272301 1.0 ml Ask for price
Mitochondrial Import Receptor Subunit TOM7 Homolog (TOMM7) Antibody
abx238864-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0442-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0442-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0442-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E04M0123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E04M0123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E04M0123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E04M0442-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E04M0442-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top