UBB

UBB Antibody
35548-100ul 100ul
EUR 252
UBB antibody
38375-100ul 100ul
EUR 252
UBB Antibody
1-CSB-PA118714
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBB. Recognizes UBB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:5-1:20
UBB Antibody
DF6852 200ul
EUR 304
Description: UBB Antibody detects endogenous levels of total UBB.
UBB Antibody
CSB-PA316022KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against UBB. Recognizes UBB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ICC, FC;WB:1:1000-1:2000, IHC:1:100-1:200, ICC:1:100-1:200, FC:1:50-1:200
UBB Antibody
CSB-PA316022KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against UBB. Recognizes UBB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ICC, FC;WB:1:1000-1:2000, IHC:1:100-1:200, ICC:1:100-1:200, FC:1:50-1:200
UBB Antibody
1-CSB-PA179850
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBB. Recognizes UBB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:10-1:25
UBB antibody
70R-50520 100 ul
EUR 244
Description: Purified Polyclonal UBB antibody
UBB siRNA
20-abx905901
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBB siRNA
20-abx938747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBB siRNA
20-abx938748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBB Antibody
ABD6852 100 ug
EUR 438
UBB antibody
PAab09865 100 ug
EUR 386
UBB Blocking Peptide
DF6852-BP 1mg
EUR 195
UBB Conjugated Antibody
C35548 100ul
EUR 397
UBB Conjugated Antibody
C38375 100ul
EUR 397
UBB cloning plasmid
CSB-CL316022HU1-10ug 10ug
EUR 303
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atgcagatcttcgtgaaaacccttaccggcaagaccatcacccttgaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaggaaggcattccccccgaccagcagaggctcatctttgcaggcaagcagctggaagacggccgtactctttctgacta
  • Show more
Description: A cloning plasmid for the UBB gene.
UBB cloning plasmid
CSB-CL316022HU2-10ug 10ug
EUR 303
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atgcagatcttcgtgaaaacccttaccggcaagaccatcacccttgaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaggaaggcattccccccgaccagcagaggctcatctttgcaggcaagcagctggaagatggccgtactctttctgacta
  • Show more
Description: A cloning plasmid for the UBB gene.
anti- UBB antibody
FNab09865 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: UBB
  • Uniprot ID: P0CG47
  • Gene ID: 7314
  • Research Area: Immunology, Metabolism
Description: Antibody raised against UBB
anti-UBB (1F5)
LF-MA10359 100 ug
EUR 363
Description: Mouse monoclonal to UBB
anti-UBB (3C12)
LF-MA30679 100 ul
EUR 527
Description: Mouse Monoclonal to UBB
anti- UBB antibody
LSMab09865 100 ug
EUR 386
pCMV-SPORT6-UBB
PVT14185 2 ug
EUR 495
Anti-UBB antibody
STJ26009 100 µl
EUR 457
Description: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants.
Anti-UBB antibody
STJ26010 100 µl
EUR 277
Description: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants.
Polyubiquitin-B (UBB) Antibody
abx016018-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Polyubiquitin-B (UBB) Antibody
20-abx214165
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyubiquitin-B (UBB) Antibody
abx117218-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Polyubiquitin-B (UBB) Antibody
20-abx125404
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyubiquitin-B (UBB) Antibody
20-abx241782
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human UBB ELISA Kit
ELA-E0164h 96 Tests
EUR 824
UBB ELISA KIT|Human
EF000472 96 Tests
EUR 689
Rat UBB shRNA Plasmid
20-abx987862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UBB shRNA Plasmid
20-abx973279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBB shRNA Plasmid
20-abx954999
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Ubiquitin B (UBB) Antibody
20-abx000577
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyubiquitin-B (UBB) Antibody
20-abx001741
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-Ubiquitin/UBB Antibody
PA1420 100ug/vial
EUR 334
Anti-Ubiquitin/UBB Antibody
PB9122 100ug/vial
EUR 334
UBB Recombinant Protein (Rat)
RP235508 100 ug Ask for price
UBB Recombinant Protein (Human)
RP033655 100 ug Ask for price
UBB Recombinant Protein (Human)
RP033658 100 ug Ask for price
UBB Recombinant Protein (Mouse)
RP182603 100 ug Ask for price
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA004354
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005763
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA005933
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
UBA52/RPS27A/UBB/UBC Antibody
1-CSB-PA006103
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA52/RPS27A/UBB/UBC. Recognizes UBA52/RPS27A/UBB/UBC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
Monoclonal UBB Antibody, Clone: 3C12
APR10629G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human UBB. The antibodies are raised in Mouse and are from clone 3C12. This antibody is applicable in WB, FC, E
UBB/UBC/RPS27A/UBA52 Antibody
1-CSB-PA374539
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against UBB/UBC/RPS27A/UBA52. Recognizes UBB/UBC/RPS27A/UBA52 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000
UBB / UBC / RPS27A / UBA52 Antibody
20-abx326873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327342
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327433
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBA52 / RPS27A / UBB / UBC Antibody
20-abx327720
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBB / UBC / RPS27A / UBA52 Antibody
20-abx328678
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin B (UBB) polyclonal antibody
ABP-PAB-10328 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
Ubb ORF Vector (Rat) (pORF)
ORF078504 1.0 ug DNA
EUR 506
UBB ORF Vector (Human) (pORF)
ORF011219 1.0 ug DNA
EUR 95
UBB ORF Vector (Human) (pORF)
ORF011220 1.0 ug DNA
EUR 95
Ubb ORF Vector (Mouse) (pORF)
ORF060869 1.0 ug DNA
EUR 506
UBB ELISA Kit (Human) (OKCA02321)
OKCA02321 96 Wells
EUR 846
Description: Description of target: Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 3.9 pg/mL
UBB ELISA Kit (Mouse) (OKEH05913)
OKEH05913 96 Wells
EUR 662
Description: Description of target: Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.183 ng/mL
UBB ELISA Kit (Rat) (OKEH06332)
OKEH06332 96 Wells
EUR 662
Description: Description of target: Ubiquitin: Exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked: Lys-6-linked may be involved in DNA repair; Lys-11-linked is involved in ERAD (endoplasmic reticulum-associated degradation) and in cell-cycle regulation; Lys-29-linked is involved in lysosomal degradation; Lys-33-linked is involved in kinase modification; Lys-48-linked is involved in protein degradation via the proteasome; Lys-63-linked is involved in endocytosis, DNA-damage responses as well as in signaling processes leading to activation of the transcription factor NF-kappa-B. Linear polymer chains formed via attachment by the initiator Met lead to cell signaling. Ubiquitin is usually conjugated to Lys residues of target proteins, however, in rare cases, conjugation to Cys or Ser residues has been observed. When polyubiquitin is free (unanchored-polyubiquitin), it also has distinct roles, such as in activation of protein kinases, and in signaling.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
Human ubiquitin B (UBB) ELISA kit
CSB-EL025429HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human ubiquitin B (UBB) ELISA kit
1-CSB-EL025429HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ubiquitin B (UBB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat ubiquitin B (UBB) ELISA kit
E02U0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat ubiquitin B (UBB) ELISA kit
E02U0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat ubiquitin B (UBB) ELISA kit
E02U0044-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit ubiquitin B (UBB) ELISA kit
E04U0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit ubiquitin B (UBB) ELISA kit
E04U0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit ubiquitin B (UBB) ELISA kit
E04U0044-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human ubiquitin B (UBB) ELISA kit
E01U0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human ubiquitin B (UBB) ELISA kit
E01U0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human ubiquitin B (UBB) ELISA kit
E01U0044-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse ubiquitin B (UBB) ELISA kit
E03U0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse ubiquitin B (UBB) ELISA kit
E03U0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ubiquitin B (UBB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top