UBE2D1

UBE2D1 antibody
70R-1158 100 ug
EUR 377
Description: Rabbit polyclonal UBE2D1 antibody
UBE2D1 antibody
70R-21098 50 ul
EUR 435
Description: Rabbit polyclonal UBE2D1 antibody
UBE2D1 Antibody
32518-100ul 100ul
EUR 252
UBE2D1 Antibody
DF6715 200ul
EUR 304
Description: UBE2D1 Antibody detects endogenous levels of total UBE2D1.
UBE2D1 Antibody
1-CSB-PA025443DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D1. Recognizes UBE2D1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200
UBE2D1 Antibody
1-CSB-PA025443GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2D1. Recognizes UBE2D1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
UBE2D1 siRNA
20-abx905904
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2D1 siRNA
20-abx938759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2D1 siRNA
20-abx938760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2D1 Antibody
ABD6715 100 ug
EUR 438
anti-UBE2D1
YF-PA24927 50 ul
EUR 334
Description: Mouse polyclonal to UBE2D1
UBE2D1 Blocking Peptide
33R-8734 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2D1 antibody, catalog no. 70R-1158
Human UBE2D1 Antibody
33207-05111 150 ug
EUR 261
UBE2D1 Blocking Peptide
DF6715-BP 1mg
EUR 195
UBE2D1 Polyclonal Antibody
A-8701 100 µl
EUR 483.55
Description: The best epigenetics products
UBE2D1-Specific Antibody
abx239167-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
UBE2D1 Conjugated Antibody
C32518 100ul
EUR 397
UBE2D1 cloning plasmid
CSB-CL025443HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggcgctgaagaggattcagaaagaattgagtgatctacagcgcgatccacctgctcactgttcagctggacctgtgggagatgacttgttccactggcaagccactattatggggcctcctgatagcgcatatcaaggtggagtcttctttctcactgtacattttccgacaga
  • Show more
Description: A cloning plasmid for the UBE2D1 gene.
UBE2D1 Polyclonal Antibody
A50580 100 µg
EUR 570.55
Description: fast delivery possible
UBE2D1 Rabbit pAb
A1951-100ul 100 ul
EUR 308
UBE2D1 Rabbit pAb
A1951-200ul 200 ul
EUR 459
UBE2D1 Rabbit pAb
A1951-20ul 20 ul
EUR 183
UBE2D1 Rabbit pAb
A1951-50ul 50 ul
EUR 223
anti- UBE2D1 antibody
FNab09167 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin-conjugating enzyme E2D 1
  • Uniprot ID: P51668
  • Gene ID: 7321
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBE2D1
Anti-UBE2D1 antibody
STJ26014 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is closely related to a stimulator of iron transport (SFT), and is up-regulated in hereditary hemochromatosis. It also functions in the ubiquitination of the tumor-suppressor protein p53 and the hypoxia-inducible transcription factor HIF1alpha by interacting with the E1 ubiquitin-activating enzyme and the E3 ubiquitin-protein ligases. Two transcript variants encoding different isoforms have been found for this gene.
Anti-UBE2D1 (2C6)
YF-MA10981 100 ug
EUR 363
Description: Mouse monoclonal to UBE2D1
UBE2D1 protein (His tag)
80R-1830 100 ug
EUR 305
Description: Purified recombinant UBE2D1 protein
UBE2D1 ELISA KIT|Human
EF003994 96 Tests
EUR 689
Rat UBE2D1 shRNA Plasmid
20-abx990283
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2D1 Antibody, HRP conjugated
1-CSB-PA025443DB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D1. Recognizes UBE2D1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2D1 Antibody, FITC conjugated
1-CSB-PA025443DC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D1. Recognizes UBE2D1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2D1 Antibody, Biotin conjugated
1-CSB-PA025443DD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2D1. Recognizes UBE2D1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human UBE2D1 shRNA Plasmid
20-abx955004
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UBE2D1 shRNA Plasmid
20-abx980969
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-UBE2D1-Specific antibody
PAab09167 100 ug
EUR 386
UBE2D1 Recombinant Protein (Rat)
RP235529 100 ug Ask for price
UBE2D1 Recombinant Protein (Human)
RP033676 100 ug Ask for price
UBE2D1 Recombinant Protein (Mouse)
RP182627 100 ug Ask for price
Human UBE2D1 Antibody (Biotin Conjugate)
33207-05121 150 ug
EUR 369
Polyclonal UBE2D1 Antibody (C-term)
APR04786G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2D1 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal UBE2D1 antibody - middle region
APR00868G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2D1 - middle region. This antibody is tested and proven to work in the following applications:
UBE2D1 Polyclonal Antibody, HRP Conjugated
A50581 100 µg
EUR 570.55
Description: reagents widely cited
UBE2D1 Polyclonal Antibody, FITC Conjugated
A50582 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2D1 Polyclonal Antibody, Biotin Conjugated
A50583 100 µg
EUR 570.55
Description: The best epigenetics products
Ube2d1 ORF Vector (Rat) (pORF)
ORF078511 1.0 ug DNA
EUR 506
UBE2D1 ORF Vector (Human) (pORF)
ORF011226 1.0 ug DNA
EUR 95
Ube2d1 ORF Vector (Mouse) (pORF)
ORF060877 1.0 ug DNA
EUR 506
Human UBE2D1 AssayLite Antibody (FITC Conjugate)
33207-05141 150 ug
EUR 428
Human UBE2D1 AssayLite Antibody (RPE Conjugate)
33207-05151 150 ug
EUR 428
Human UBE2D1 AssayLite Antibody (APC Conjugate)
33207-05161 150 ug
EUR 428
Human UBE2D1 AssayLite Antibody (PerCP Conjugate)
33207-05171 150 ug
EUR 471
Ube2d1 sgRNA CRISPR Lentivector set (Mouse)
K4929001 3 x 1.0 ug
EUR 339
Ube2d1 sgRNA CRISPR Lentivector set (Rat)
K7532001 3 x 1.0 ug
EUR 339
UBE2D1 sgRNA CRISPR Lentivector set (Human)
K2570801 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
20-abx116461
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
abx122735-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
abx031522-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
abx031522-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
20-abx302459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Monoclonal UBE2D1 Antibody (monoclonal) (M01), Clone: 2C6
AMM04272G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UBE2D1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C6. This antibody is applicable in WB and IHC, E
Ubiquitin-Conjugating Enzyme E2 D1 (UBE2D1) Antibody
20-abx001594
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ube2d1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4929002 1.0 ug DNA
EUR 154
Ube2d1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4929003 1.0 ug DNA
EUR 154
Ube2d1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4929004 1.0 ug DNA
EUR 154
Ube2d1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7532002 1.0 ug DNA
EUR 154
Ube2d1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7532003 1.0 ug DNA
EUR 154
Ube2d1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7532004 1.0 ug DNA
EUR 154
UBE2D1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2570802 1.0 ug DNA
EUR 154
UBE2D1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2570803 1.0 ug DNA
EUR 154
UBE2D1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2570804 1.0 ug DNA
EUR 154
UBE2D1 Protein Vector (Mouse) (pPB-C-His)
PV243506 500 ng
EUR 603
UBE2D1 Protein Vector (Mouse) (pPB-N-His)
PV243507 500 ng
EUR 603
UBE2D1 Protein Vector (Mouse) (pPM-C-HA)
PV243508 500 ng
EUR 603
UBE2D1 Protein Vector (Mouse) (pPM-C-His)
PV243509 500 ng
EUR 603
UBE2D1 Protein Vector (Rat) (pPB-C-His)
PV314042 500 ng
EUR 603

Back to top