ULBP2

Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit
DLR-ULBP2-Hu-96T 96T
EUR 725
  • Should the Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human UL16 Binding Brotein 2 (ULBP2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit
RDR-ULBP2-Hu-48Tests 48 Tests
EUR 589
Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit
RDR-ULBP2-Hu-96Tests 96 Tests
EUR 820
Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit
RD-ULBP2-Hu-48Tests 48 Tests
EUR 563
Human UL16 Binding Brotein 2 (ULBP2) ELISA Kit
RD-ULBP2-Hu-96Tests 96 Tests
EUR 783
ULBP2 antibody
70R-21165 50 ul
EUR 435
Description: Rabbit polyclonal ULBP2 antibody
ULBP2 Antibody
1-CSB-PA880151ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULBP2. Recognizes ULBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ULBP2 Antibody
1-CSB-PA025610GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ULBP2. Recognizes ULBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ULBP2 siRNA
20-abx939003
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ULBP2
YF-PA21081 50 ug
EUR 363
Description: Mouse polyclonal to ULBP2
ULBP2 Polyclonal Antibody
28866-100ul 100ul
EUR 252
ULBP2 Polyclonal Antibody
28866-50ul 50ul
EUR 187
ULBP2, human recombinant
7334-100
EUR 370
ULBP2 cloning plasmid
CSB-CL880151HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atggcagcagccgccgctaccaagatccttctgtgcctcccgcttctgctcctgctgtccggctggtcccgggctgggcgagccgaccctcactctctttgctatgacatcaccgtcatccctaagttcagacctggaccacggtggtgtgcggttcaaggccaggtggatgaaaa
  • Show more
Description: A cloning plasmid for the ULBP2 gene.
ULBP2 Rabbit pAb
A8264-100ul 100 ul
EUR 308
ULBP2 Rabbit pAb
A8264-200ul 200 ul
EUR 459
ULBP2 Rabbit pAb
A8264-20ul 20 ul
EUR 183
ULBP2 Rabbit pAb
A8264-50ul 50 ul
EUR 223
ULBP2 Rabbit pAb
A15194-100ul 100 ul
EUR 308
ULBP2 Rabbit pAb
A15194-200ul 200 ul
EUR 459
ULBP2 Rabbit pAb
A15194-20ul 20 ul
EUR 183
ULBP2 Rabbit pAb
A15194-50ul 50 ul
EUR 223
anti- ULBP2 antibody
FNab09250 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: UL16 binding protein 2
  • Uniprot ID: Q9BZM5
  • Gene ID: 80328
  • Research Area: Cancer
Description: Antibody raised against ULBP2
Anti-ULBP2 antibody
PAab09250 100 ug
EUR 412
Anti-ULBP2 antibody
STJ110563 100 µl
EUR 277
Description: This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells. This gene is located in a cluster of multiple MHC class I-related genes on chromosome 6.
Anti-ULBP2 antibody
STJ117388 100 µl
EUR 277
Description: This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells. This gene is located in a cluster of multiple MHC class I-related genes on chromosome 6.
Polyclonal ULBP2 Antibody (Center)
APR04174G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULBP2 (Center). This antibody is tested and proven to work in the following applications:
ULBP2 protein (His tag)
80R-2332 100 ug
EUR 322
Description: Purified recombinant Human ULBP2 Protein (His tag)
Human ULBP2 ELISA Kit
EHU0022 96Tests
EUR 521
Human ULBP2 ELISA Kit
ELA-E2254h 96 Tests
EUR 824
Bovine ULBP2 ELISA Kit
EBU0022 96Tests
EUR 521
Anserini ULBP2 ELISA Kit
EAU0022 96Tests
EUR 521
Chicken ULBP2 ELISA Kit
ECKU0022 96Tests
EUR 521
Canine ULBP2 ELISA Kit
ECU0022 96Tests
EUR 521
Goat ULBP2 ELISA Kit
EGTU0022 96Tests
EUR 521
ULBP2 ELISA KIT|Human
EF006257 96 Tests
EUR 689
ULBP2 Polyclonal Conjugated Antibody
C28866 100ul
EUR 397
Human ULBP2 shRNA Plasmid
20-abx962858
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Sheep ULBP2 ELISA Kit
ESU0022 96Tests
EUR 521
Porcine ULBP2 ELISA Kit
EPU0022 96Tests
EUR 521
Rabbit ULBP2 ELISA Kit
ERTU0022 96Tests
EUR 521
Rat ULBP2 ELISA Kit
ERU0022 96Tests
EUR 521
Monkey ULBP2 ELISA Kit
EMKU0022 96Tests
EUR 521
Mouse ULBP2 ELISA Kit
EMU0022 96Tests
EUR 521
Recombinant Human ULBP2 Protein
RP00267 5 μg
EUR 136
ULBP2 Recombinant Protein (Human)
RP033958 100 ug Ask for price
NKG2D Ligand 2 (ULBP2) Antibody
20-abx005773
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
NKG2D Ligand 2 (ULBP2) Antibody
20-abx142298
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
NKG2D Ligand 2 (ULBP2) Antibody
abx029272-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
NKG2D Ligand 2 (ULBP2) Antibody
abx029272-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
NKG2D Ligand 2 (ULBP2) Antibody
abx239250-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
ELISA kit for Human ULBP2
EK5763 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ULBP2 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ULBP2 PicoKine ELISA Kit
EK1593 96 wells
EUR 425
Description: For quantitative detection of human ULBP2 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Guinea Pig ULBP2 ELISA Kit
EGU0022 96Tests
EUR 521
NKG2D Ligand 2 (ULBP2) Antibody
20-abx320552
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ULBP2 ORF Vector (Human) (pORF)
ORF011320 1.0 ug DNA
EUR 95
ULBP2 ELISA Kit (Human) (OKBB01116)
OKBB01116 96 Wells
EUR 505
Description: Description of target: UL16 binding protein 2 (ULBP2) is a cell surface glycoprotein encoded by ULBP2 gene located on the chromosome 6. This gene encodes a major histocompatibility complex (MHC) class I-related molecule that binds to the NKG2D receptor on natural killer (NK) cells to trigger release of multiple cytokines and chemokines that in turn contribute to the recruitment and activation of NK cells. The encoded protein undergoes further processing to generate the mature protein that is either anchored to membrane via a glycosylphosphatidylinositol moiety, or secreted. Many malignant cells secrete the encoded protein to evade immunosurveillance by NK cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <12pg/ml
ULBP2 ELISA Kit (Human) (OKCD09332)
OKCD09332 96 Wells
EUR 909
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
Ul16 Binding Protein 2 (ULBP2) Antibody
20-abx116525
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
UL16 Binding Protein 2 (ULBP2) Antibody
20-abx128390
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
UL16 Binding Protein 2 (ULBP2) Antibody
20-abx175032
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
ULBP2 sgRNA CRISPR Lentivector set (Human)
K2587201 3 x 1.0 ug
EUR 339
Recombinant UL16 Binding Brotein 2 (ULBP2)
4-RPL882Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BZM5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human UL16 Binding Brotein 2 expressed in: E.coli
Human UL16 Binding Protein 2 (ULBP2) Protein
20-abx166896
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human NKG2D ligand 2 (ULBP2) ELISA Kit
abx251525-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human ULBP2(NKG2D ligand 2) ELISA Kit
EH2185 96T
EUR 567.6
  • Detection range: 12.5-800IU/ml
  • Uniprot ID: Q9BZM5
  • Alias: ULBP2/ALCAN-alpha/N2DL2/NKG2DL2/RAET1H/ALCAN-alpha/N2DL2/N2DL-2/NKG2D ligand 2/RAET1HNKG2DL2/retinoic acid early transcript 1 H/Retinoic acid early transcript 1H/UL16 binding protein 2/UL16-bin
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 7.5IU/ml
Human ULBP2/ NKG2D ligand 2 ELISA Kit
E2641Hu 1 Kit
EUR 571
Human NKG2D ligand 2, ULBP2 ELISA KIT
ELI-07220h 96 Tests
EUR 824
ULBP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2587202 1.0 ug DNA
EUR 154
ULBP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2587203 1.0 ug DNA
EUR 154
ULBP2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2587204 1.0 ug DNA
EUR 154
ULBP2 Protein Vector (Human) (pPB-C-His)
PV045277 500 ng
EUR 329
ULBP2 Protein Vector (Human) (pPB-N-His)
PV045278 500 ng
EUR 329
ULBP2 Protein Vector (Human) (pPM-C-HA)
PV045279 500 ng
EUR 329
ULBP2 Protein Vector (Human) (pPM-C-His)
PV045280 500 ng
EUR 329

Back to top