Purine-rich element binding protein B attenuates the coactivator function of myocardin by a novel molecular mechanism of smooth muscle gene repression

Myocardin is a potent transcriptional coactivator protein, which features as the grasp regulator of vascular smooth muscle cell differentiation. The cofactor exercise of myocardin is mediated by its bodily interplay with serum response issue, a ubiquitously expressed transactivator that binds to CArG packing containers in genes encoding smooth muscle-restricted proteins. Purine-rich element binding protein B (Purβ) represses the transcription of the smooth muscle α-actin gene (Acta2) in fibroblasts and smooth muscle cells by interacting with single-stranded DNA sequences flanking two 5′ CArG packing containers in the Acta2 promoter.

In this examine, the skill of Purβ to modulate the cofactor exercise of myocardin was investigated utilizing a mixture of mobile and biochemical approaches. Results of smooth muscle gene promoter-reporter assays indicated that Purβ particularly inhibits the coactivator function of myocardin in a method requiring the presence of all three single-stranded DNA binding domains in the Purβ homodimer. DNA binding analyses demonstrated that Purβ interacts with CArG-containing DNA components with a a lot decrease affinity in comparison with different purine-rich goal sequences current in the Acta2 promoter.

Co-immunoprecipitation and DNA pull-down assays revealed that Purβ associates with myocardin and serum response issue when free or certain to duplex DNA containing a number of CArG packing containers. Functional evaluation of engineered Purβ level mutants recognized a number of amino acid residues important for suppression of myocardin exercise. Collectively, these findings recommend an inhibitory mechanism involving direct protein-protein interplay between the homodimeric Purβ repressor and the myocardin-serum response factor-CArG advanced.

Contaminations in sequencing information, particularly in reference genomes, result in inevitable errors in downstream analyses. Similarly, presence of contaminants in transcriptomes, misrepresents the molecular foundation of varied interactions. In this examine, we report the presence of a giant quantity of plant transcriptomes contaminated with RNAs encoding POU area proteins; a household of proteins that has not been reported in crops and fungi. Besides, our findings illustrated that there are 4 POU area protein-coding sequences in the reference genome of Rhodamnia argentea

DNA damage-signaling, homologous recombination and genetic mutation induced by 5-azacytidine and DNA-protein crosslinks in Escherichia coli

Covalent linkage between DNA and proteins produces extremely poisonous lesions and could be brought about by generally used chemotherapeutic brokers, by inside and exterior chemical substances and by radiation. In this examine, utilizing Escherichia coli, we examine the penalties of 5-azacytidine (5-azaC), which traps covalent complexes between itself and the Dcm cytosine methyltransferase protein. DNA protein crosslink-dependent results could be ascertained by results that come up in wild-type however not in dcmΔ strains.

We discover that 5-azaC induces the bacterial DNA injury response and stimulates homologous recombination, a element of which is Dcm-dependent. Template-switching at an imperfect inverted repeat (“quasipalindrome”, QP) is strongly enhanced by 5-azaC and this enhancement was fully Dcm-dependent and impartial of double-strand break restore. The SOS response helps ameliorate the mutagenic impact of 5-azaC however this isn’t a outcome of SOS-induced DNA polymerases since their induction, particularly PolIV, appears to stimulate QP-associated mutagenesis.

Cell division regulator SulA was additionally required for restoration of QP mutants induced by 5-azaC. In the absence of Lon protease, Dcm-dependent QP-mutagenesis is strongly elevated, suggesting it might play a position in DPC tolerance. Deletions at brief tandem repeats, which happen likewise by a replication template-switch, are elevated, however solely modestly, by 5-azaC. We see proof for Dcm-dependent and-independent killing by 5-azaC in delicate mutants, akin to recA, recB, and lon; homologous recombination and deletion mutations are additionally stimulated partially by a Dcm-independent impact of 5-azaC. Whether this happens by a completely different protein/DNA crosslink or by an alternate kind of DNA injury is unknown.

Purine-rich element binding protein B attenuates the coactivator function of myocardin by a novel molecular mechanism of smooth muscle gene repression

Pseudohypoparathyroidism Type 1A with Normocalcaemia, resulting from the Novel C.389A>G Variant of Exon 5 of the Guanine Nucleotide-Binding Protein, α-Stimulating Gene

Pseudohypoparathyroidism kind 1A (PHP1A) is a uncommon illness brought about by molecular defects in the maternally-inherited allele of the guanine nucleotide-binding protein, α-stimulating (GNAS) gene. The GNAS gene encodes the stimulatory G-protein α-subunit that regulates manufacturing of the second messenger cyclic adenosine monophosphate. Heterozygous inactivating mutations in these particular loci are liable for a spectrum of phenotypic traits of the illness, together with medical options of the Albright’s hereditary osteodystrophy, resulting from resistance to parathyroid hormone (PTH).

We report a case of PHP1A and discover the underlying novel level mutation of the GNAS gene that results in an atypical PHP1A phenotype. A male affected person with a spherical face, brief stature, and brachydactyly accompanied by normocalcaemia and delicate PTH resistance consulted at our heart. The GNAS encoding area from the affected person and each of his dad and mom have been amplified and sequenced instantly in a pattern of peripheral blood leukocytes. A novel c.389A>G level mutation in exon 5 of the GNAS gene, leading to a p.Tyr130Cys peptidic chain change of the Gsα protein, detected in the proband, in heterozygous state.

Human Cullin 1 (CUL1) Protein

20-abx168953
  • EUR 551.00
  • EUR 258.00
  • EUR 1609.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CUL1 antibody

20R-1302 100 ug
EUR 377
Description: Rabbit polyclonal CUL1 antibody

CUL1 antibody

70R-16670 50 ul
EUR 435
Description: Rabbit polyclonal CUL1 antibody

CUL1 antibody

70R-14095 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CUL1 antibody

CUL1 Antibody

32618-100ul 100ul
EUR 252

CUL1 Antibody

43243-100ul 100ul
EUR 252

CUL1 Antibody

1-CSB-PA006218GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CUL1 Antibody

1-CSB-PA001830
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

CUL1 Antibody

CSB-PA083531-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

CUL1 Antibody

CSB-PA083531-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

CUL1 Antibody

1-CSB-PA614436ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:1000

CUL1 Antibody

1-CSB-PA614436ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CUL1. Recognizes CUL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CUL1 Antibody

DF6859 200ul
EUR 304
Description: CUL1 Antibody detects endogenous levels of total CUL1.

CUL1 siRNA

20-abx913188
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUL1 siRNA

20-abx913189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUL1 Antibody

ABD6859 100 ug
EUR 438

CUL1 protein (His tag)

80R-1515 50 ug
EUR 305
Description: Purified recombinant Human CUL1 protein

CUL1 Recombinant Protein (Rat)

RP196811 100 ug Ask for price

CUL1 Recombinant Protein (Mouse)

RP126764 100 ug Ask for price

CUL1 ELISA KIT|Human

EF008916 96 Tests
EUR 689

Human CUL1 shRNA Plasmid

20-abx955542
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CUL1 Cullin-1 Human Recombinant Protein

PROTQ13616 Regular: 10ug
EUR 317
Description: CUL1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 430 amino acids (1- 410a.a.) and having a molecular mass of 49.4kDa.;CUL1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CUL1 Blocking Peptide

33R-3827 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CUL1 antibody, catalog no. 20R-1302

CUL1 Blocking Peptide

DF6859-BP 1mg
EUR 195

CUL1 Conjugated Antibody

C32618 100ul
EUR 397

CUL1 cloning plasmid

CSB-CL614436HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atgcaagctcggaatcaatatttagttttgagtgtggagaatagattgtttttttcttttatatatataaacaaaatgtcctatgtgtttcaacgatggtaccaaaagtatttcttgctcttatctcttaactttgaaaaggaccccaaaatgtatgtacagacagtgcttgatg
  • Show more
Description: A cloning plasmid for the CUL1 gene.

CUL1 cloning plasmid

CSB-CL614436HU2-10ug 10ug
EUR 762
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2331
  • Sequence: ATGTCGTCAACCCGGAGCCAGAACCCCCACGGCCTGAAGCAGATTGGCCTGGACCAGATCTGGGACGACCTCAGAGCCGGCATCCAGCAGGTGTACACACGGCAGAGCATGGCCAAGTCCAGATATATGGAGCTCTACACTCATGTTTATAACTACTGTACTAGTGTTCACCAGT
  • Show more
Description: A cloning plasmid for the CUL1 gene.

CUL1 Rabbit pAb

A2136-100ul 100 ul
EUR 308

CUL1 Rabbit pAb

A2136-200ul 200 ul
EUR 459

CUL1 Rabbit pAb

A2136-20ul 20 ul
EUR 183

CUL1 Rabbit pAb

A2136-50ul 50 ul
EUR 223

anti- CUL1 antibody

FNab02073 100µg
EUR 505.25
  • Immunogen: cullin 1
  • Uniprot ID: Q13616
  • Gene ID: 8454
  • Research Area: Cancer, Cell Division and Proliferation, Metabolism
Description: Antibody raised against CUL1

Anti-CUL1 antibody

PAab02073 100 ug
EUR 355

Anti-CUL1 antibody

STJ23289 100 µl
EUR 277

CUL1 ORF Vector (Human) (pORF)

ORF002794 1.0 ug DNA
EUR 95

CUL1 ORF Vector (Human) (pORF)

ORF012787 1.0 ug DNA
EUR 354

CUL1 Protein Vector (Human) (pPB-C-His)

PV011173 500 ng
EUR 329

CUL1 Protein Vector (Human) (pPB-N-His)

PV011174 500 ng
EUR 329

CUL1 Protein Vector (Human) (pPM-C-HA)

PV011175 500 ng
EUR 329

CUL1 Protein Vector (Human) (pPM-C-His)

PV011176 500 ng
EUR 329

CUL1 Protein Vector (Human) (pPB-C-His)

PV051145 500 ng
EUR 481

CUL1 Protein Vector (Human) (pPB-N-His)

PV051146 500 ng
EUR 481

CUL1 Protein Vector (Human) (pPM-C-HA)

PV051147 500 ng
EUR 481

CUL1 Protein Vector (Human) (pPM-C-His)

PV051148 500 ng
EUR 481

Recombinant Human CUL1 Protein, His, E.coli-10ug

QP11567-10ug 10ug
EUR 201

Recombinant Human CUL1 Protein, His, E.coli-1mg

QP11567-1mg 1mg
EUR 5251

Recombinant Human CUL1 Protein, His, E.coli-2ug

QP11567-2ug 2ug
EUR 155

Cullin 1 (CUL1) Antibody

20-abx008528
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

20-abx116818
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

abx037825-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

20-abx130464
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cullin 1 (CUL1) Antibody

20-abx013050
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

abx028739-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

abx028739-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse CUL1 shRNA Plasmid

20-abx973806
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cullin 1 (CUL1) Antibody

20-abx320103
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

20-abx321517
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

abx331499-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

20-abx326122
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cullin 1 (CUL1) Antibody

abx232073-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cullin 1 (CUL1) Antibody

20-abx001748
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Cullin 1 (CUL1)

4-RPC412Hu01
  • EUR 390.30
  • EUR 208.00
  • EUR 1188.64
  • EUR 462.88
  • EUR 825.76
  • EUR 324.00
  • EUR 2821.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13616
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cullin 1 expressed in: E.coli

Human Cullin 1(CUL1) ELISA kit

E01C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 1(CUL1) ELISA kit

E01C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 1(CUL1) ELISA kit

E01C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin- 1, CUL1 ELISA KIT

ELI-26493h 96 Tests
EUR 824

Human Cullin 1 (CUL1) ELISA Kit

abx386735-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CUL1 sgRNA CRISPR Lentivector set (Human)

K0532301 3 x 1.0 ug
EUR 339

Cullin 1 (CUL1) Polyclonal Antibody (Human)

4-PAC412Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1)

Human Cullin 1(CUL1)ELISA Kit

QY-E05018 96T
EUR 361

CUL1 Protein Vector (Mouse) (pPB-C-His)

PV169022 500 ng
EUR 1065

CUL1 Protein Vector (Mouse) (pPB-N-His)

PV169023 500 ng
EUR 1065

CUL1 Protein Vector (Mouse) (pPM-C-HA)

PV169024 500 ng
EUR 1065

CUL1 Protein Vector (Mouse) (pPM-C-His)

PV169025 500 ng
EUR 1065

CUL1 Protein Vector (Rat) (pPB-C-His)

PV262418 500 ng
EUR 1166

CUL1 Protein Vector (Rat) (pPB-N-His)

PV262419 500 ng
EUR 1166

CUL1 Protein Vector (Rat) (pPM-C-HA)

PV262420 500 ng
EUR 1166

CUL1 Protein Vector (Rat) (pPM-C-His)

PV262421 500 ng
EUR 1166

Anti-Cullin 1/Cul1 Antibody

PA1557 100ug/vial
EUR 334

Cul1 ORF Vector (Rat) (pORF)

ORF065605 1.0 ug DNA
EUR 506

Cul1 ORF Vector (Mouse) (pORF)

ORF042256 1.0 ug DNA
EUR 506

Anti-Cullin 1/CUL1 Antibody

PB9542 100ug/vial
EUR 294

CUL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0532302 1.0 ug DNA
EUR 154

CUL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0532303 1.0 ug DNA
EUR 154

CUL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0532304 1.0 ug DNA
EUR 154

Cullin 1 (CUL1) Polyclonal Antibody (Human), APC

4-PAC412Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with APC.

Cullin 1 (CUL1) Polyclonal Antibody (Human), Biotinylated

4-PAC412Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with Biotin.

Cullin 1 (CUL1) Polyclonal Antibody (Human), Cy3

4-PAC412Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with Cy3.

Cullin 1 (CUL1) Polyclonal Antibody (Human), FITC

4-PAC412Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with FITC.

Cullin 1 (CUL1) Polyclonal Antibody (Human), HRP

4-PAC412Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with HRP.

Cullin 1 (CUL1) Polyclonal Antibody (Human), PE

4-PAC412Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with PE.

Recombinant Schizosaccharomyces Pombe cul1 Protein (aa 1-767)

VAng-Yyj5643-inquire inquire Ask for price
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Cullin-1 (cul1), partial, recombinant protein.

CUL1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704097 1.0 ug DNA
EUR 450

CUL1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704101 1.0 ug DNA
EUR 450

CUL1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704102 1.0 ug DNA
EUR 450

Cullin 1 (CUL1) Polyclonal Antibody (Human), APC-Cy7

4-PAC412Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUL1 (Met1~Glu250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cullin 1 (CUL1). This antibody is labeled with APC-Cy7.

Rat Cullin 1(CUL1) ELISA kit

E02C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 1(CUL1) ELISA kit

E02C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 1(CUL1) ELISA kit

E02C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 1(CUL1) ELISA kit

E03C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 1(CUL1) ELISA kit

E03C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 1(CUL1) ELISA kit

E03C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 1(CUL1) ELISA kit

E06C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 1(CUL1) ELISA kit

E06C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 1(CUL1) ELISA kit

E06C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 1(CUL1) ELISA kit

E04C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 1(CUL1) ELISA kit

E04C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 1(CUL1) ELISA kit

E04C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 1(CUL1) ELISA kit

E09C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 1(CUL1) ELISA kit

E09C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 1(CUL1) ELISA kit

E09C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 1(CUL1) ELISA kit

E08C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 1(CUL1) ELISA kit

E08C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 1(CUL1) ELISA kit

E08C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 1(CUL1) ELISA kit

E07C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 1(CUL1) ELISA kit

E07C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 1(CUL1) ELISA kit

E07C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin- 1, Cul1 ELISA KIT

ELI-26494m 96 Tests
EUR 865

Cul1 sgRNA CRISPR Lentivector set (Mouse)

K4984601 3 x 1.0 ug
EUR 339

Cul1 sgRNA CRISPR Lentivector set (Rat)

K6613601 3 x 1.0 ug
EUR 339

Polyclonal Cullin 1 / CUL1 Antibody (aa727-776)

APR02922G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cullin 1 / CUL1 (aa727-776). This antibody is tested and proven to work in the following applications:

Polyclonal Cullin 1 / CUL1 Antibody (C-Terminus)

APR02207G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cullin 1 / CUL1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Guinea pig Cullin 1(CUL1) ELISA kit

E05C2181-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 1(CUL1) ELISA kit

E05C2181-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 1(CUL1) ELISA kit

E05C2181-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 1(CUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cul1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4984602 1.0 ug DNA
EUR 154

Cul1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4984603 1.0 ug DNA
EUR 154

Cul1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4984604 1.0 ug DNA
EUR 154

Cul1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6613602 1.0 ug DNA
EUR 154

Cul1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6613603 1.0 ug DNA
EUR 154

Cul1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6613604 1.0 ug DNA
EUR 154

Cul1 3'UTR GFP Stable Cell Line

TU154552 1.0 ml Ask for price

Cul1 3'UTR Luciferase Stable Cell Line

TU104552 1.0 ml Ask for price

Cul1 3'UTR Luciferase Stable Cell Line

TU202964 1.0 ml Ask for price

Cul1 3'UTR GFP Stable Cell Line

TU252964 1.0 ml Ask for price

CUL1 3'UTR GFP Stable Cell Line

TU055276 1.0 ml
EUR 4617

CUL1 3'UTR Luciferase Stable Cell Line

TU005276 1.0 ml
EUR 4617

CUL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0532305 3 x 1.0 ug
EUR 376

CUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV620887 1.0 ug DNA
EUR 1355

CUL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV620891 1.0 ug DNA
EUR 1355

Sequencing of the GNAS gene from his dad and mom didn’t reveal the c.389A>G mutation, confirming a de novo proband genotype. The maternal origin of the affected GNAS allele, together with delicate PTH resistance, confirmed the PHP1A prognosis. PHP1A, brought about by inactivating GNAS mutations, presents a vary of advanced medical phenotypes. The novel c.389A>G GNAS mutation introduced on this case expands the spectrum of identified PHP1A molecular defects and describes the related phenotype.

Glenda Montgomery

Back to top