ADAMTSL1

ADAMTSL1 Antibody

1-CSB-PA131728
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTSL1. Recognizes ADAMTSL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ADAMTSL1 Antibody

1-CSB-PA777393
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTSL1. Recognizes ADAMTSL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ADAMTSL1 Antibody

1-CSB-PA818715ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ADAMTSL1. Recognizes ADAMTSL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ADAMTSL1 siRNA

20-abx906779
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTSL1 siRNA

20-abx906780
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ADAMTSL1

YF-PA21770 50 ul
EUR 363
Description: Mouse polyclonal to ADAMTSL1

ADAMTSL1 Conjugated Antibody

C36045 100ul
EUR 397

ADAMTSL1 cloning plasmid

CSB-CL818715HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: atggaatgctgccgtcgggcaactcctggcacactgctcctctttctggctttcctgctcctgagttccaggaccgcacgctccgaggaggaccgggacggcctatgggatgcctggggcccatggagtgaatgctcacgcacctgcgggggaggggcctcctactctctgaggc
  • Show more
Description: A cloning plasmid for the ADAMTSL1 gene.

ADAMTSL1 cloning plasmid

CSB-CL818715HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: ATGTGTTTGACTGATGAGTGGGGTTTTTTGTTTTTTTTTTTCTTCCTAGGAGTGCCTGAAGCTGAAGTCACTTGGTTCAGGAATAAAAGCAAACTGGGCTCCCCGCACCATCTGCACGAAGGCTCCTTGCTGCTCACAAACGTGTCCTCCTCGGATCAGGGCCTGTACTCCTGCA
  • Show more
Description: A cloning plasmid for the ADAMTSL1 gene.

ADAMTSL1 Rabbit pAb

A8073-100ul 100 ul
EUR 308

ADAMTSL1 Rabbit pAb

A8073-200ul 200 ul
EUR 459

ADAMTSL1 Rabbit pAb

A8073-20ul 20 ul
EUR 183

ADAMTSL1 Rabbit pAb

A8073-50ul 50 ul
EUR 223

Anti-ADAMTSL1 antibody

STJ110376 100 µl
EUR 277
Description: This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins.

Mouse ADAMTSL1 shRNA Plasmid

20-abx978823
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTSL1 shRNA Plasmid

20-abx964176
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS Like 1 (ADAMTSL1) Antibody

20-abx211508
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAMTS Like 1 (ADAMTSL1) Antibody

20-abx211509
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAMTSL1 ORF Vector (Human) (pORF)

ORF000181 1.0 ug DNA
EUR 95

ADAMTSL1 ORF Vector (Human) (pORF)

ORF012153 1.0 ug DNA
EUR 354

Adamtsl1 ORF Vector (Mouse) (pORF)

ORF038118 1.0 ug DNA
EUR 1572

ADAMTSL1 ELISA Kit (Human) (OKCA01093)

OKCA01093 96 Wells
EUR 846
Description: Description of target: This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

ADAMTS-Like Protein 1 (ADAMTSL1) Antibody

20-abx005893
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAMTS-Like Protein 1 (ADAMTSL1) Antibody

20-abx320244
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adamtsl1 sgRNA CRISPR Lentivector set (Mouse)

K4976001 3 x 1.0 ug
EUR 339

ADAMTSL1 sgRNA CRISPR Lentivector set (Human)

K0045501 3 x 1.0 ug
EUR 339

Adamtsl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4976002 1.0 ug DNA
EUR 154

Adamtsl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4976003 1.0 ug DNA
EUR 154

Adamtsl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4976004 1.0 ug DNA
EUR 154

ADAMTSL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0045502 1.0 ug DNA
EUR 154

ADAMTSL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0045503 1.0 ug DNA
EUR 154

ADAMTSL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0045504 1.0 ug DNA
EUR 154

ADAMTSL1 Protein Vector (Mouse) (pPB-C-His)

PV152470 500 ng
EUR 2923

ADAMTSL1 Protein Vector (Mouse) (pPB-N-His)

PV152471 500 ng
EUR 2923

ADAMTSL1 Protein Vector (Mouse) (pPM-C-HA)

PV152472 500 ng
EUR 2923

ADAMTSL1 Protein Vector (Mouse) (pPM-C-His)

PV152473 500 ng
EUR 2923

ADAMTSL1 Protein Vector (Human) (pPB-His-MBP)

PV319918 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPB-His-GST)

PV319919 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPB-C-His)

PV000721 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPB-N-His)

PV000722 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPM-C-HA)

PV000723 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPM-C-His)

PV000724 500 ng
EUR 329

ADAMTSL1 Protein Vector (Human) (pPB-C-His)

PV048609 500 ng
EUR 481

ADAMTSL1 Protein Vector (Human) (pPB-N-His)

PV048610 500 ng
EUR 481

ADAMTSL1 Protein Vector (Human) (pPM-C-HA)

PV048611 500 ng
EUR 481

ADAMTSL1 Protein Vector (Human) (pPM-C-His)

PV048612 500 ng
EUR 481

Adamtsl1 3'UTR Luciferase Stable Cell Line

TU101403 1.0 ml Ask for price

Adamtsl1 3'UTR GFP Stable Cell Line

TU151403 1.0 ml Ask for price

Adamtsl1 3'UTR Luciferase Stable Cell Line

TU200286 1.0 ml Ask for price

Adamtsl1 3'UTR GFP Stable Cell Line

TU250286 1.0 ml Ask for price

Back to top