DAG1

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Hu-96T 96T
EUR 673
  • Should the Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin Associated Glycoprotein 1 (DAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Mu-48T 48T
EUR 527
  • Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids.

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Mu-96T 96T
EUR 688
  • Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids.

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Hu-48Tests 48 Tests
EUR 544

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Hu-96Tests 96 Tests
EUR 756

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Mu-48Tests 48 Tests
EUR 557

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Mu-96Tests 96 Tests
EUR 774

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Hu-48Tests 48 Tests
EUR 521

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Hu-96Tests 96 Tests
EUR 723

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Mu-48Tests 48 Tests
EUR 533

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Mu-96Tests 96 Tests
EUR 740

DAG1 antibody

70R-16733 50 ul
EUR 435
Description: Rabbit polyclonal DAG1 antibody

DAG1 Antibody

1-CSB-PA613486NA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

DAG1 Antibody

DF10349 200ul
EUR 304
Description: DAG1 Antibody detects endogenous levels of DAG1.

DAG1 Antibody

1-CSB-PA006488GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DAG1 antibody

70R-6688 50 ug
EUR 467
Description: Rabbit polyclonal DAG1 antibody

Dag1 antibody

70R-8652 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Dag1 antibody

DAG1 siRNA

20-abx913543
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAG1 siRNA

20-abx913544
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAG1 Polyclonal Antibody

27283-100ul 100ul
EUR 252

DAG1 Polyclonal Antibody

27283-50ul 50ul
EUR 187

DAG1 Rabbit pAb

A10076-100ul 100 ul
EUR 308

DAG1 Rabbit pAb

A10076-200ul 200 ul
EUR 459

DAG1 Rabbit pAb

A10076-20ul 20 ul
EUR 183

DAG1 Rabbit pAb

A10076-50ul 50 ul
EUR 223

DAG1 Blocking Peptide

33R-1265 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POMT2 antibody, catalog no. 70R-6997

Dag1 Blocking Peptide

33R-7277 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Dag1 antibody, catalog no. 70R-8652

DAG1 Blocking Peptide

DF10349-BP 1mg
EUR 195

DAG1 Polyclonal Antibody

ABP58328-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910
  • Applications tips:
Description: A polyclonal antibody for detection of DAG1 from Human, Mouse. This DAG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910

DAG1 Polyclonal Antibody

ABP58328-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910
  • Applications tips:
Description: A polyclonal antibody for detection of DAG1 from Human, Mouse. This DAG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910

DAG1 Polyclonal Antibody

ABP58328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910
  • Applications tips:
Description: A polyclonal antibody for detection of DAG1 from Human, Mouse. This DAG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910

DAG1 (pY892) Antibody

abx149722-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

DAG1 cloning plasmid

CSB-CL613486HU-10ug 10ug
EUR 863
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2688
  • Sequence: atgaggatgtctgtgggcctctcgctgctgctgcccctctgggggaggacctttctcctcctgctctctgtggttatggctcagtcccactggcccagtgaaccctcagaggctgtcagggactgggaaaaccagcttgaggcatccatgcactcagtgctctcagacctccacg
  • Show more
Description: A cloning plasmid for the DAG1 gene.

DAG1 Polyclonal Antibody

ES8965-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DAG1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DAG1 Polyclonal Antibody

ES8965-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DAG1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-DAG1 antibody

STJ112116 100 µl
EUR 277
Description: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. Certain mutations in this gene are known to cause distinct forms of muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein.

Anti-DAG1 antibody

STJ72268 100 µg
EUR 359

Anti-DAG1 antibody

STJ190123 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DAG1

DAG1 (Phospho-Tyr892) Antibody

12556-100ul 100ul
EUR 252

DAG1 (Phospho-Tyr892) Antibody

12556-50ul 50ul
EUR 187

DAG1 Antibody, HRP conjugated

1-CSB-PA613486NB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DAG1 Antibody, FITC conjugated

1-CSB-PA613486NC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DAG1 Antibody, Biotin conjugated

1-CSB-PA613486ND01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dystroglycan 1 (DAG1) Antibody

20-abx112212
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystroglycan 1 (DAG1) Antibody

20-abx135994
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DAG1 ELISA KIT|Human

EF006751 96 Tests
EUR 689

DAG1 Polyclonal Conjugated Antibody

C27283 100ul
EUR 397

Dystroglycan 1 (DAG1) Antibody

abx432586-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Phospho-DAG1 (Tyr892) Antibody

AF8216 200ul
EUR 376
Description: DAG1 (Phospho-Tyr892) Antibody detects endogenous levels of DAG1 only when phosphorylated at Tyr892.

Mouse DAG1 shRNA Plasmid

20-abx969941
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DAG1 shRNA Plasmid

20-abx951128
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DAG1 (Phospho- Tyr892) Antibody

ABF8216 100 ug
EUR 438

Canine DAG1 ELISA KIT

ELI-32378d 96 Tests
EUR 928

Polyclonal DAG1 Antibody (C-term)

AMRa00050G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAG1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DAG1 Antibody (internal region)

AMRa00051G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DAG1 (internal region). This antibody is tested and proven to work in the following applications:

Rat Dystroglycan(DAG1) ELISA kit

E02D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dystroglycan(DAG1) ELISA kit

E02D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dystroglycan(DAG1) ELISA kit

E02D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dystroglycan(DAG1) ELISA kit

E01D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dystroglycan(DAG1) ELISA kit

E01D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dystroglycan(DAG1) ELISA kit

E01D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dystroglycan(DAG1) ELISA kit

E03D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dystroglycan(DAG1) ELISA kit

E03D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dystroglycan(DAG1) ELISA kit

E03D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dystroglycan(DAG1) ELISA kit

E06D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dystroglycan(DAG1) ELISA kit

E06D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Dystroglycan(DAG1) ELISA kit

E06D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top