NPL

NPL antibody

70R-18938 50 ul
EUR 435
Description: Rabbit polyclonal NPL antibody

NPL Antibody

42953-100ul 100ul
EUR 252

NPL Antibody

1-CSB-PA874830LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPL. Recognizes NPL from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:200

NPL Antibody

1-CSB-PA015994GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NPL. Recognizes NPL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

NPL siRNA

20-abx903621
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPL siRNA

20-abx926257
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPL siRNA

20-abx926258
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pBluescriptR-NPL

PVT18192 2 ug
EUR 231

Human NPL Antibody

32962-05111 150 ug
EUR 261

NPL Conjugated Antibody

C42953 100ul
EUR 397

NPL cloning plasmid

CSB-CL874830HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atggccttcccaaagaagaaacttcagggtcttgtggctgcaaccatcacgccaatgactgagaatggagaaatcaacttttcagtaattggtcagtatgtggattatcttgtgaaagaacagggagtgaagaacatttttgtgaatggcacaacaggagaaggcctgtccctgag
  • Show more
Description: A cloning plasmid for the NPL gene.

NPL cloning plasmid

CSB-CL874830HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 963
  • Sequence: ATGGCCTTCCCAAAGAAGAAACTTCAGGGTCTTGTGGCTGCAACCATCACGCCAATGACTGAGAATGGAGAAATCAACTTTTCAGTAATTGGTCAGTATGTGGATTATCTTGTGAAAGAACAGGGAGTGAAGAACATTTTTGTGAATGGCACAACAGGAGAAGGCCTGTCCCTGAG
  • Show more
Description: A cloning plasmid for the NPL gene.

NPL cloning plasmid

CSB-CL874830HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: ATGGCCTTCCCAAAGAAGAAACTTCAGGGTCTTGTGGCTGCAACCATCACGCCAATGACTGAGAATGGAGAAATCAACTTTTCAGTAATTGGTCAGTATGTGGATTATCTTGTGAAAGAACAGGGAGTGAAGAACATTTTTGTGAATGGCACAACAGGAGAAGGCCTGTCCCTGAG
  • Show more
Description: A cloning plasmid for the NPL gene.

NPL Rabbit pAb

A9210-100ul 100 ul
EUR 308

NPL Rabbit pAb

A9210-200ul 200 ul
EUR 459

NPL Rabbit pAb

A9210-20ul 20 ul
EUR 183

NPL Rabbit pAb

A9210-50ul 50 ul
EUR 223

anti- NPL antibody

FNab05820 100µg
EUR 505.25
  • Immunogen: N-acetylneuraminate pyruvate lyase(dihydrodipicolinate synthase)
  • Uniprot ID: Q9BXD5
  • Gene ID: 80896
  • Research Area: Metabolism
Description: Antibody raised against NPL

Anti-NPL antibody

PAab05820 100 ug
EUR 355

Anti-NPL antibody

STJ113623 100 µl
EUR 277
Description: This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

NPL Antibody, HRP conjugated

1-CSB-PA874830LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPL. Recognizes NPL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NPL Antibody, FITC conjugated

1-CSB-PA874830LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPL. Recognizes NPL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NPL Antibody, Biotin conjugated

1-CSB-PA874830LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPL. Recognizes NPL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NPL protein (His tag)

80R-1785 100 ug
EUR 305
Description: Purified recombinant Human NPL protein

NPL ELISA KIT|Human

EF001304 96 Tests
EUR 689

Rat NPL shRNA Plasmid

20-abx989297
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NPL shRNA Plasmid

20-abx978080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NPL shRNA Plasmid

20-abx962939
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPL Recombinant Protein (Human)

RP021538 100 ug Ask for price

NPL Recombinant Protein (Human)

RP041722 100 ug Ask for price

NPL Recombinant Protein (Human)

RP041725 100 ug Ask for price

NPL Recombinant Protein (Mouse)

RP154721 100 ug Ask for price

NPL Recombinant Protein (Rat)

RP214349 100 ug Ask for price

Human NPL Antibody (Biotin Conjugate)

32962-05121 150 ug
EUR 369

Narcissus pseudonarcissus lectin (NPA/NPL

05-0119-10 10 mg
EUR 231

Narcissus pseudonarcissus lectin (NPA/NPL

05-0119-1000 1 g Ask for price

Narcissus pseudonarcissus lectin (NPA/NPL

05-0119-50 50 mg
EUR 722

N-Acetylneuraminate Lyase (NPL) Antibody

20-abx113976
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

20-abx124803
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

abx122123-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

abx030633-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

abx030633-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

abx235820-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

N-Acetylneuraminate Lyase (NPL) Antibody

20-abx317934
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Npl ORF Vector (Rat) (pORF)

ORF071451 1.0 ug DNA
EUR 506

NPL ORF Vector (Human) (pORF)

ORF013908 1.0 ug DNA
EUR 354

NPL ORF Vector (Human) (pORF)

ORF013909 1.0 ug DNA
EUR 354

NPL ORF Vector (Human) (pORF)

ORF007180 1.0 ug DNA
EUR 95

Npl ORF Vector (Mouse) (pORF)

ORF051575 1.0 ug DNA
EUR 506

Human NPL AssayLite Antibody (FITC Conjugate)

32962-05141 150 ug
EUR 428

Human NPL AssayLite Antibody (RPE Conjugate)

32962-05151 150 ug
EUR 428

Human NPL AssayLite Antibody (APC Conjugate)

32962-05161 150 ug
EUR 428

Human NPL AssayLite Antibody (PerCP Conjugate)

32962-05171 150 ug
EUR 471

N-Acetylneuraminate Lyase (NPL) Antibody (HRP)

20-abx316724
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody (FITC)

20-abx316725
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acetylneuraminate Lyase (NPL) Antibody (Biotin)

20-abx316726
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Npl sgRNA CRISPR Lentivector set (Rat)

K6323701 3 x 1.0 ug
EUR 339

NPL sgRNA CRISPR Lentivector set (Human)

K1446501 3 x 1.0 ug
EUR 339

Npl sgRNA CRISPR Lentivector set (Mouse)

K4700701 3 x 1.0 ug
EUR 339

Rat N acetylneuraminate lyase(NPL) ELISA kit

E02N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acetylneuraminate lyase(NPL) ELISA kit

E02N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acetylneuraminate lyase(NPL) ELISA kit

E02N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit

E01N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit

E01N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit

E01N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acetylneuraminate lyase(NPL) ELISA kit

E04N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acetylneuraminate lyase(NPL) ELISA kit

E04N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acetylneuraminate lyase(NPL) ELISA kit

E04N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acetylneuraminate lyase(NPL) ELISA kit

E03N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acetylneuraminate lyase(NPL) ELISA kit

E03N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acetylneuraminate lyase(NPL) ELISA kit

E03N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acetylneuraminate lyase(NPL) ELISA kit

E06N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acetylneuraminate lyase(NPL) ELISA kit

E06N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acetylneuraminate lyase(NPL) ELISA kit

E06N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acetylneuraminate lyase(NPL) ELISA kit

E08N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acetylneuraminate lyase(NPL) ELISA kit

E08N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acetylneuraminate lyase(NPL) ELISA kit

E08N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig N acetylneuraminate lyase(NPL) ELISA kit

E07N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig N acetylneuraminate lyase(NPL) ELISA kit

E07N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig N acetylneuraminate lyase(NPL) ELISA kit

E07N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acetylneuraminate lyase(NPL) ELISA kit

E09N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acetylneuraminate lyase(NPL) ELISA kit

E09N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acetylneuraminate lyase(NPL) ELISA kit

E09N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N- acetylneuraminate lyase, NPL ELISA KIT

ELI-21267h 96 Tests
EUR 824

Porcine N- acetylneuraminate lyase, NPL ELISA KIT

ELI-22106p 96 Tests
EUR 928

Bovine N- acetylneuraminate lyase, NPL ELISA KIT

ELI-44135b 96 Tests
EUR 928

Chicken N- acetylneuraminate lyase, NPL ELISA KIT

ELI-44608c 96 Tests
EUR 928

Rat N-acetylneuraminate lyase (NPL) ELISA Kit

abx391656-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human N-acetylneuraminate lyase (NPL) ELISA Kit

abx381863-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse N-acetylneuraminate lyase (NPL) ELISA Kit

abx389975-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse N- acetylneuraminate lyase, Npl ELISA KIT

ELI-36925m 96 Tests
EUR 865

Npl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6323702 1.0 ug DNA
EUR 154

Npl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6323703 1.0 ug DNA
EUR 154

Npl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6323704 1.0 ug DNA
EUR 154

NPL sgRNA CRISPR Lentivector (Human) (Target 1)

K1446502 1.0 ug DNA
EUR 154

Back to top