PDIA5

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit

DLR-PDIA5-Hu-96T 96T
EUR 673
  • Should the Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Disulfide Isomerase A5 (PDIA5) in samples from tissue homogenates or other biological fluids.

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit

RDR-PDIA5-Hu-48Tests 48 Tests
EUR 544

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit

RDR-PDIA5-Hu-96Tests 96 Tests
EUR 756

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit

RD-PDIA5-Hu-48Tests 48 Tests
EUR 521

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit

RD-PDIA5-Hu-96Tests 96 Tests
EUR 723

Pdia5/ Rat Pdia5 ELISA Kit

ELI-45005r 96 Tests
EUR 886

PDIA5 antibody

70R-19186 50 ul
EUR 435
Description: Rabbit polyclonal PDIA5 antibody

PDIA5 Antibody

47722-100ul 100ul
EUR 252

PDIA5 Antibody

1-CSB-PA614533LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PDIA5 Antibody

1-CSB-PA017723GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PDIA5 siRNA

20-abx903912
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDIA5 siRNA

20-abx928136
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDIA5 siRNA

20-abx928137
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PDIA5

PVT14225 2 ug
EUR 495

PDIA5 Rabbit pAb

A14389-100ul 100 ul
EUR 308

PDIA5 Rabbit pAb

A14389-200ul 200 ul
EUR 459

PDIA5 Rabbit pAb

A14389-20ul 20 ul
EUR 183

PDIA5 Rabbit pAb

A14389-50ul 50 ul
EUR 223

PDIA5 Rabbit pAb

A14476-100ul 100 ul
EUR 308

PDIA5 Rabbit pAb

A14476-200ul 200 ul
EUR 459

PDIA5 Rabbit pAb

A14476-20ul 20 ul
EUR 183

PDIA5 Rabbit pAb

A14476-50ul 50 ul
EUR 223

PDIA5 Conjugated Antibody

C47722 100ul
EUR 397

PDIA5 cloning plasmid

CSB-CL614533HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atggcgcgggccgggccggcgtggctgctgctggcaatctgggtggtcctgccatcatggctgtcctctgcaaaggtctcctcgctcattgagagaatctctgaccccaaggacttgaaaaaactgctcagaacccggaataatgtactggtgctttactccaaatctgaggtggc
  • Show more
Description: A cloning plasmid for the PDIA5 gene.

PDIA5 Polyclonal Antibody

A60218 100 µg
EUR 570.55
Description: fast delivery possible

Anti-PDIA5 antibody

STJ116601 100 µl
EUR 277
Description: This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. The N-terminal TRX-like domain is the primary binding site for the major ER chaperone calreticulin and possibly other proteins and substrates as well. Alternative splicing results in multiple protein- and non-protein-coding transcript variants.

Anti-PDIA5 antibody

STJ116686 100 µl
EUR 277
Description: This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. The N-terminal TRX-like domain is the primary binding site for the major ER chaperone calreticulin and possibly other proteins and substrates as well. Alternative splicing results in multiple protein- and non-protein-coding transcript variants.

PDIA5 Antibody, HRP conjugated

1-CSB-PA614533LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PDIA5 Antibody, FITC conjugated

1-CSB-PA614533LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PDIA5 Antibody, Biotin conjugated

1-CSB-PA614533LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PDIA5 ELISA KIT|Human

EF008705 96 Tests
EUR 689

Rat PDIA5 shRNA Plasmid

20-abx990092
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PDIA5 shRNA Plasmid

20-abx977812
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PDIA5 shRNA Plasmid

20-abx957476
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PDIA5 Recombinant Protein (Human)

RP022924 100 ug Ask for price

PDIA5 Recombinant Protein (Mouse)

RP161072 100 ug Ask for price

PDIA5 Recombinant Protein (Rat)

RP219884 100 ug Ask for price

Polyclonal PDIA5 Antibody (C-term)

APR03913G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDIA5 (C-term). This antibody is tested and proven to work in the following applications:

PDIA5 Polyclonal Antibody, Biotin Conjugated

A60219 100 µg
EUR 570.55
Description: reagents widely cited

PDIA5 Polyclonal Antibody, FITC Conjugated

A60220 100 µg
EUR 570.55
Description: Ask the seller for details

PDIA5 Polyclonal Antibody, HRP Conjugated

A60221 100 µg
EUR 570.55
Description: The best epigenetics products

Pdia5 ORF Vector (Rat) (pORF)

ORF073296 1.0 ug DNA
EUR 506

PDIA5 ORF Vector (Human) (pORF)

ORF007642 1.0 ug DNA
EUR 95

Pdia5 ORF Vector (Mouse) (pORF)

ORF053692 1.0 ug DNA
EUR 506

PDIA5 ELISA Kit (Human) (OKCD08535)

OKCD08535 96 Wells
EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

PDIA5 ELISA Kit (Human) (OKDD00464)

OKDD00464 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

Protein Disulfide Isomerase A5 (PDIA5) Antibody

abx027813-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody

abx027813-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody

20-abx128192
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody

20-abx174249
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protein Disulfide Isomerase A5 (PDIA5) Antibody

abx340094-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody

20-abx302770
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pdia5 sgRNA CRISPR Lentivector set (Mouse)

K4687401 3 x 1.0 ug
EUR 339

Pdia5 sgRNA CRISPR Lentivector set (Rat)

K6295801 3 x 1.0 ug
EUR 339

PDIA5 sgRNA CRISPR Lentivector set (Human)

K1621601 3 x 1.0 ug
EUR 339

Back to top