Cullin 1 human protein and gene

PDIA5

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit
DLR-PDIA5-Hu-96T	DL Develop	96T	EUR 673
Should the Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Disulfide Isomerase A5 (PDIA5) in samples from tissue homogenates or other biological fluids.

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit
RDR-PDIA5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit
RDR-PDIA5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit
RD-PDIA5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Protein Disulfide Isomerase A5 (PDIA5) ELISA Kit
RD-PDIA5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Pdia5/ Rat Pdia5 ELISA Kit
ELI-45005r	Lifescience Market	96 Tests	EUR 886

PDIA5 antibody
70R-19186	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PDIA5 antibody

PDIA5 Antibody
47722-100ul	SAB	100ul	EUR 252

PDIA5 Antibody
1-CSB-PA614533LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PDIA5 Antibody
1-CSB-PA017723GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PDIA5 siRNA
20-abx903912	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PDIA5 siRNA
20-abx928136	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PDIA5 siRNA
20-abx928137	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-PDIA5
PVT14225	Lifescience Market	2 ug	EUR 495

PDIA5 Rabbit pAb
A14389-100ul	Abclonal	100 ul	EUR 308

PDIA5 Rabbit pAb
A14389-200ul	Abclonal	200 ul	EUR 459

PDIA5 Rabbit pAb
A14389-20ul	Abclonal	20 ul	EUR 183

PDIA5 Rabbit pAb
A14389-50ul	Abclonal	50 ul	EUR 223

PDIA5 Rabbit pAb
A14476-100ul	Abclonal	100 ul	EUR 308

PDIA5 Rabbit pAb
A14476-200ul	Abclonal	200 ul	EUR 459

PDIA5 Rabbit pAb
A14476-20ul	Abclonal	20 ul	EUR 183

PDIA5 Rabbit pAb
A14476-50ul	Abclonal	50 ul	EUR 223

PDIA5 Conjugated Antibody
C47722	SAB	100ul	EUR 397

PDIA5 cloning plasmid
CSB-CL614533HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 789 Sequence: atggcgcgggccgggccggcgtggctgctgctggcaatctgggtggtcctgccatcatggctgtcctctgcaaaggtctcctcgctcattgagagaatctctgaccccaaggacttgaaaaaactgctcagaacccggaataatgtactggtgctttactccaaatctgaggtggc Show more
Description: A cloning plasmid for the PDIA5 gene.

PDIA5 Polyclonal Antibody
A60218	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-PDIA5 antibody
STJ116601	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. The N-terminal TRX-like domain is the primary binding site for the major ER chaperone calreticulin and possibly other proteins and substrates as well. Alternative splicing results in multiple protein- and non-protein-coding transcript variants.

Anti-PDIA5 antibody
STJ116686	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. The N-terminal TRX-like domain is the primary binding site for the major ER chaperone calreticulin and possibly other proteins and substrates as well. Alternative splicing results in multiple protein- and non-protein-coding transcript variants.

PDIA5 Antibody, HRP conjugated
1-CSB-PA614533LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PDIA5 Antibody, FITC conjugated
1-CSB-PA614533LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PDIA5 Antibody, Biotin conjugated
1-CSB-PA614533LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PDIA5. Recognizes PDIA5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PDIA5 ELISA KIT\|Human
EF008705	Lifescience Market	96 Tests	EUR 689

Rat PDIA5 shRNA Plasmid
20-abx990092	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PDIA5 shRNA Plasmid
20-abx977812	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PDIA5 shRNA Plasmid
20-abx957476	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PDIA5 Recombinant Protein (Human)
RP022924	ABM	100 ug	Ask for price

PDIA5 Recombinant Protein (Mouse)
RP161072	ABM	100 ug	Ask for price

PDIA5 Recombinant Protein (Rat)
RP219884	ABM	100 ug	Ask for price

Polyclonal PDIA5 Antibody (C-term)
APR03913G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDIA5 (C-term). This antibody is tested and proven to work in the following applications:

PDIA5 Polyclonal Antibody, Biotin Conjugated
A60219	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PDIA5 Polyclonal Antibody, FITC Conjugated
A60220	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PDIA5 Polyclonal Antibody, HRP Conjugated
A60221	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Pdia5 ORF Vector (Rat) (pORF)
ORF073296	ABM	1.0 ug DNA	EUR 506

PDIA5 ORF Vector (Human) (pORF)
ORF007642	ABM	1.0 ug DNA	EUR 95

Pdia5 ORF Vector (Mouse) (pORF)
ORF053692	ABM	1.0 ug DNA	EUR 506

PDIA5 ELISA Kit (Human) (OKCD08535)
OKCD08535	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

PDIA5 ELISA Kit (Human) (OKDD00464)
OKDD00464	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

Protein Disulfide Isomerase A5 (PDIA5) Antibody
abx027813-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody
abx027813-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody
20-abx128192	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody
20-abx174249	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Protein Disulfide Isomerase A5 (PDIA5) Antibody
abx340094-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein Disulfide Isomerase A5 (PDIA5) Antibody
20-abx302770	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pdia5 sgRNA CRISPR Lentivector set (Mouse)
K4687401	ABM	3 x 1.0 ug	EUR 339

Pdia5 sgRNA CRISPR Lentivector set (Rat)
K6295801	ABM	3 x 1.0 ug	EUR 339

PDIA5 sgRNA CRISPR Lentivector set (Human)
K1621601	ABM	3 x 1.0 ug	EUR 339

Back to top