RPS20

RPS20 antibody
70R-20004 50 ul
EUR 435
Description: Rabbit polyclonal RPS20 antibody
RPS20 Antibody
34335-100ul 100ul
EUR 252
RPS20 Antibody
34335-50ul 50ul
EUR 187
RPS20 Antibody
49001-100ul 100ul
EUR 333
RPS20 Antibody
49001-50ul 50ul
EUR 239
RPS20 Antibody
DF3681 200ul
EUR 304
Description: RPS20 Antibody detects endogenous levels of total RPS20.
RPS20 Antibody
1-CSB-PA040274
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS20. Recognizes RPS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000
RPS20 Antibody
CSB-PA176463-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS20. Recognizes RPS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
RPS20 Antibody
CSB-PA176463-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS20. Recognizes RPS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500
RPS20 antibody
70R-33922 100 ug
EUR 327
Description: Rabbit polyclonal RPS20 antibody
RPS20 Antibody
1-CSB-PA020394GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS20. Recognizes RPS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RPS20 siRNA
20-abx904696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS20 siRNA
20-abx932057
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS20 siRNA
20-abx932058
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS20 Antibody
ABD3681 100 ug
EUR 438
anti-RPS20
YF-PA24631 50 ul
EUR 334
Description: Mouse polyclonal to RPS20
RPS20 Rabbit pAb
A10363-100ul 100 ul
EUR 308
RPS20 Rabbit pAb
A10363-200ul 200 ul
EUR 459
RPS20 Rabbit pAb
A10363-20ul 20 ul
EUR 183
RPS20 Rabbit pAb
A10363-50ul 50 ul
EUR 223
RPS20 Blocking Peptide
DF3681-BP 1mg
EUR 195
RPS20 Blocking Peptide
20-abx061816
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS20 Conjugated Antibody
C49001 100ul
EUR 397
RPS20 Conjugated Antibody
C34335 100ul
EUR 397
RPS20 cloning plasmid
CSB-CL020394HU-10ug 10ug
EUR 210
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 360
  • Sequence: atggcttttaaggataccggaaaaacacccgtggagccggaggtggcaattcaccgaattcgaatcaccctaacaagccgcaacgtaaaatccttggaaaaggtgtgtgctgacttgataagaggcgcaaaagaaaagaatctcaaagtgaaaggaccagttcgaatgcctaccaa
  • Show more
Description: A cloning plasmid for the RPS20 gene.
RPS20 Rabbit pAb
A4096-100ul 100 ul
EUR 308
RPS20 Rabbit pAb
A4096-200ul 200 ul
EUR 459
RPS20 Rabbit pAb
A4096-20ul 20 ul Ask for price
RPS20 Rabbit pAb
A4096-50ul 50 ul Ask for price
anti- RPS20 antibody
FNab07464 100µg
EUR 548.75
  • Immunogen: ribosomal protein S20
  • Uniprot ID: P60866
  • Gene ID: 6224
  • Research Area: Metabolism
Description: Antibody raised against RPS20
Anti-RPS20 antibody
PAab07464 100 ug
EUR 386
Anti-RPS20 antibody
STJ25403 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the small nucleolar RNA gene U54, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Two transcript variants encoding different isoforms have been identified for this gene.
Anti-RPS20 antibody
STJ112400 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the small nucleolar RNA gene U54, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Two transcript variants encoding different isoforms have been identified for this gene.
Anti-RPS20 (1G12)
YF-MA15278 100 ug
EUR 363
Description: Mouse monoclonal to RPS20
RPS20 protein (His tag)
80R-3602 50 ug
EUR 424
Description: Purified recombinant RPS20 protein (His tag)
RPS20 ELISA KIT|Human
EF002621 96 Tests
EUR 689
Mouse RPS20 shRNA Plasmid
20-abx976135
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS20 shRNA Plasmid
20-abx987484
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS20 shRNA Plasmid
20-abx954189
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS20 recombinant monoclonal antibody
A5336 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human RPS20 for WB, IHC,ELISA
pCMV-SPORT6.1-RPS20 Plasmid
PVT16024 2 ug
EUR 325
RPS20 Recombinant Protein (Human)
RP027151 100 ug Ask for price
RPS20 Recombinant Protein (Mouse)
RP169217 100 ug Ask for price
RPS20 Recombinant Protein (Rat)
RP226820 100 ug Ask for price
Ribosomal Protein S20 (RPS20) Antibody
20-abx003015
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
20-abx115259
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
abx122991-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
20-abx126496
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
20-abx141118
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
20-abx014099
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
abx028649-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
abx028649-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
abx237464-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S20 (RPS20) Antibody
20-abx329545
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S20 (RPS20) Antibody
abx332301-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Rps20 ORF Vector (Rat) (pORF)
ORF075608 1.0 ug DNA
EUR 506
RPS20 ORF Vector (Human) (pORF)
ORF009051 1.0 ug DNA
EUR 95
Rps20 ORF Vector (Mouse) (pORF)
ORF056407 1.0 ug DNA
EUR 506
Anti-RPS20/Ribosomal Protein S20 Antibody
A06634 100ul
EUR 397
Description: Rabbit Polyclonal RPS20/Ribosomal Protein S20 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Rps20 sgRNA CRISPR Lentivector set (Rat)
K7067501 3 x 1.0 ug
EUR 339
Rps20 sgRNA CRISPR Lentivector set (Mouse)
K4533901 3 x 1.0 ug
EUR 339
RPS20 sgRNA CRISPR Lentivector set (Human)
K2039901 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S20 (RPS20) ELISA Kit
abx382946-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rps20 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7067502 1.0 ug DNA
EUR 154
Rps20 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7067503 1.0 ug DNA
EUR 154
Rps20 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7067504 1.0 ug DNA
EUR 154
Rps20 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4533902 1.0 ug DNA
EUR 154
Rps20 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4533903 1.0 ug DNA
EUR 154
Rps20 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4533904 1.0 ug DNA
EUR 154
RPS20 sgRNA CRISPR Lentivector (Human) (Target 1)
K2039902 1.0 ug DNA
EUR 154
RPS20 sgRNA CRISPR Lentivector (Human) (Target 2)
K2039903 1.0 ug DNA
EUR 154
RPS20 sgRNA CRISPR Lentivector (Human) (Target 3)
K2039904 1.0 ug DNA
EUR 154
RPS20 Ribosomal Protein S20 Human Recombinant Protein
PROTP60866 Regular: 10ug
EUR 317
Description: RPS20 Human Recombinant produced in E. coli is. a single polypeptide chain containing 165 amino acids (1-142) and having a molecular mass of 18.4kDa. RPS20 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
RPS20 Protein Vector (Rat) (pPB-C-His)
PV302430 500 ng
EUR 603
RPS20 Protein Vector (Rat) (pPB-N-His)
PV302431 500 ng
EUR 603
RPS20 Protein Vector (Rat) (pPM-C-HA)
PV302432 500 ng
EUR 603
RPS20 Protein Vector (Rat) (pPM-C-His)
PV302433 500 ng
EUR 603
RPS20 Protein Vector (Mouse) (pPB-C-His)
PV225626 500 ng
EUR 603
RPS20 Protein Vector (Mouse) (pPB-N-His)
PV225627 500 ng
EUR 603
RPS20 Protein Vector (Mouse) (pPM-C-HA)
PV225628 500 ng
EUR 603
RPS20 Protein Vector (Mouse) (pPM-C-His)
PV225629 500 ng
EUR 603
RPS20 Protein Vector (Human) (pPB-C-His)
PV036201 500 ng
EUR 329
RPS20 Protein Vector (Human) (pPB-N-His)
PV036202 500 ng
EUR 329
RPS20 Protein Vector (Human) (pPM-C-HA)
PV036203 500 ng
EUR 329
RPS20 Protein Vector (Human) (pPM-C-His)
PV036204 500 ng
EUR 329

Back to top