RPS27L antibody
70R-20008 50 ul
EUR 435
Description: Rabbit polyclonal RPS27L antibody
RPS27L Antibody
47263-100ul 100ul
EUR 252
RPS27L Antibody
47851-100ul 100ul
EUR 252
RPS27L Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS27L. Recognizes RPS27L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
RPS27L Antibody
DF3683 200ul
EUR 304
Description: RPS27L Antibody detects endogenous levels of total RPS27L.
RPS27L antibody
70R-4341 50 ug
EUR 467
Description: Rabbit polyclonal RPS27L antibody raised against the N terminal of RPS27L
RPS27L Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS27L. Recognizes RPS27L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS27L Antibody
ABD3683 100 ug
EUR 438
RPS27L Rabbit pAb
A15833-100ul 100 ul
EUR 308
RPS27L Rabbit pAb
A15833-200ul 200 ul
EUR 459
RPS27L Rabbit pAb
A15833-20ul 20 ul
EUR 183
RPS27L Rabbit pAb
A15833-50ul 50 ul
EUR 223
RPS27L Blocking Peptide
33R-6290 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS27L antibody, catalog no. 70R-4341
RPS27L Blocking Peptide
DF3683-BP 1mg
EUR 195
RPS27L Conjugated Antibody
C47851 100ul
EUR 397
RPS27L Conjugated Antibody
C47263 100ul
EUR 397
RPS27L cloning plasmid
CSB-CL758272HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 255
  • Sequence: atgcctttggctagagatttactacatccgtccttggaagaggaaaagaaaaaacataaagagaaacgcctagtacaaagtccaaattcttactttatggatgtaaaatgtccaggttgctacaagatcaccacggttttcagccatgctcagacagtggttctttgtgtaggttg
  • Show more
Description: A cloning plasmid for the RPS27L gene.
RPS27L cloning plasmid
CSB-CL758272HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Show more
Description: A cloning plasmid for the RPS27L gene.
anti- RPS27L antibody
FNab07472 100µg
EUR 548.75
  • Immunogen: ribosomal protein S27-like
  • Uniprot ID: Q71UM5
  • Gene ID: 51065
  • Research Area: Metabolism
Description: Antibody raised against RPS27L
Anti-RPS27L antibody
PAab07472 100 ug
EUR 386
Anti-RPS27L antibody
STJ118292 100 µl
EUR 277
EF002628 96 Tests
EUR 689
Rat RPS27L shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RPS27L shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RPS27L shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS27L Recombinant Protein (Human)
RP043009 100 ug Ask for price
RPS27L Recombinant Protein (Human)
RP027172 100 ug Ask for price
RPS27L Recombinant Protein (Mouse)
RP169250 100 ug Ask for price
Polyclonal RPS27L Antibody (aa1-50)
APR03100G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPS27L (aa1-50). This antibody is tested and proven to work in the following applications:
RPS27L ORF Vector (Human) (pORF)
ORF014337 1.0 ug DNA
EUR 354
RPS27L ORF Vector (Human) (pORF)
ORF009058 1.0 ug DNA
EUR 95
Rps27l ORF Vector (Mouse) (pORF)
ORF056418 1.0 ug DNA
EUR 506
Ribosomal Protein S27 Like (RPS27L) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ribosomal Protein S27 Like (RPS27L) Antibody
abx237472-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S27 Like (RPS27L) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps27l sgRNA CRISPR Lentivector set (Mouse)
K4954801 3 x 1.0 ug
EUR 339
RPS27L sgRNA CRISPR Lentivector set (Human)
K2056001 3 x 1.0 ug
EUR 339
Rps27l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4954802 1.0 ug DNA
EUR 154
Rps27l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4954803 1.0 ug DNA
EUR 154
Rps27l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4954804 1.0 ug DNA
EUR 154
RPS27L sgRNA CRISPR Lentivector (Human) (Target 1)
K2056002 1.0 ug DNA
EUR 154
RPS27L sgRNA CRISPR Lentivector (Human) (Target 2)
K2056003 1.0 ug DNA
EUR 154
RPS27L sgRNA CRISPR Lentivector (Human) (Target 3)
K2056004 1.0 ug DNA
EUR 154
RPS27L Protein Vector (Human) (pPB-C-His)
PV057345 500 ng
EUR 481
RPS27L Protein Vector (Human) (pPB-N-His)
PV057346 500 ng
EUR 481
RPS27L Protein Vector (Human) (pPM-C-HA)
PV057347 500 ng
EUR 481
RPS27L Protein Vector (Human) (pPM-C-His)
PV057348 500 ng
EUR 481
RPS27L Protein Vector (Mouse) (pPB-C-His)
PV225670 500 ng
EUR 603
RPS27L Protein Vector (Mouse) (pPB-N-His)
PV225671 500 ng
EUR 603
RPS27L Protein Vector (Mouse) (pPM-C-HA)
PV225672 500 ng
EUR 603
RPS27L Protein Vector (Mouse) (pPM-C-His)
PV225673 500 ng
EUR 603
RPS27L Protein Vector (Human) (pPB-C-His)
PV036229 500 ng
EUR 329
RPS27L Protein Vector (Human) (pPB-N-His)
PV036230 500 ng
EUR 329
RPS27L Protein Vector (Human) (pPM-C-HA)
PV036231 500 ng
EUR 329
RPS27L Protein Vector (Human) (pPM-C-His)
PV036232 500 ng
EUR 329
Rps27l 3'UTR Luciferase Stable Cell Line
TU118154 1.0 ml Ask for price
Rps27l 3'UTR GFP Stable Cell Line
TU168154 1.0 ml Ask for price
Rps27l 3'UTR Luciferase Stable Cell Line
TU219697 1.0 ml Ask for price
Rps27l 3'UTR GFP Stable Cell Line
TU269697 1.0 ml Ask for price
RPS27L 3'UTR GFP Stable Cell Line
TU072241 1.0 ml
EUR 1394
RPS27L 3'UTR Luciferase Stable Cell Line
TU022241 1.0 ml
EUR 1394
Human Ribosomal Protein S27 Like (RPS27L) ELISA Kit
abx382952-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
RPS27L Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV706065 1.0 ug DNA
EUR 450
RPS27L Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV706069 1.0 ug DNA
EUR 450
RPS27L Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV706070 1.0 ug DNA
EUR 450
Rabbit 40S ribosomal protein S27 like(RPS27L) ELISA kit
E04R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S27 like(RPS27L) ELISA kit
E04R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S27 like(RPS27L) ELISA kit
E04R0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E02R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E02R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E02R0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S27 like(RPS27L) ELISA kit
E03R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S27 like(RPS27L) ELISA kit
E03R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 40S ribosomal protein S27 like(RPS27L) ELISA kit
E03R0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S27 like(RPS27L) ELISA kit
E01R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S27 like(RPS27L) ELISA kit
E01R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 40S ribosomal protein S27 like(RPS27L) ELISA kit
E01R0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E06R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E06R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 40S ribosomal protein S27 like(RPS27L) ELISA kit
E06R0142-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 40S ribosomal protein S27 like(RPS27L) ELISA kit
E08R0142-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 40S ribosomal protein S27 like(RPS27L) ELISA kit
E08R0142-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S27 like(RPS27L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Back to top