SUMO1

SUMO1 protein
30R-1301 100 ug
EUR 278
Description: Purified recombinant Human SUMO1 protein
SUMO1 protein
30R-2785 100 ug
EUR 336
Description: Purified recombinant Human SUMO1 protein
SUMO1 protein
30R-3038 500 ug
EUR 354
Description: Purified recombinant SUMO1 protein
Sumo1 antibody
70R-30811 100 ug
EUR 327
Description: Rabbit polyclonal Sumo1 antibody
Sumo1 Antibody
33525-100ul 100ul
EUR 252
Sumo1 Antibody
33525-50ul 50ul
EUR 187
SUMO1 Antibody
32614-100ul 100ul
EUR 252
SUMO1 Antibody
1-CSB-PA004192
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
SUMO1 Antibody
1-CSB-PA912507
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
SUMO1 Antibody
1-CSB-PA973952
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200
SUMO1 Antibody
DF6853 200ul
EUR 304
Description: SUMO1 Antibody detects endogenous levels of total SUMO1.
SUMO1 Antibody
1-CSB-PA314476
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:100-1:500, IHC:1:25-1:100
SUMO1 Antibody
CSB-PA042567-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
SUMO1 Antibody
CSB-PA042567-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
SUMO1 antibody
70R-50525 100 ul
EUR 244
Description: Purified Polyclonal SUMO1 antibody
Sumo1 Antibody
AF0280 200ul
EUR 304
Description: Sumo1 antibody detects endogenous levels of total Sumo1.
SUMO1 Antibody
CSB-PA022948KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ICC, IP, FC;WB:1:500-1:2000, IHC:1:20-1:200, ICC:1:50-1:200, IP:1:20-1:50, FC:1:20-1:50
SUMO1 Antibody
CSB-PA022948KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SUMO1. Recognizes SUMO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ICC, IP, FC;WB:1:500-1:2000, IHC:1:20-1:200, ICC:1:50-1:200, IP:1:20-1:50, FC:1:20-1:50
SUMO1 siRNA
20-abx905374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO1 siRNA
20-abx935664
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO1 siRNA
20-abx935665
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO1 Antibody
ABD6853 100 ug
EUR 438
Sumo1 Antibody
ABF0280 100 ug
EUR 438
anti-SUMO1
LF-PA0128 100 ul
EUR 334
Description: Rabbit polyclonal to SUMO1
SUMO1 Rabbit pAb
A0825-100ul 100 ul
EUR 308
SUMO1 Rabbit pAb
A0825-200ul 200 ul
EUR 459
SUMO1 Rabbit pAb
A0825-20ul 20 ul Ask for price
SUMO1 Rabbit pAb
A0825-50ul 50 ul Ask for price
SUMO1 Rabbit pAb
A12529-100ul 100 ul
EUR 308
SUMO1 Rabbit pAb
A12529-200ul 200 ul
EUR 459
SUMO1 Rabbit pAb
A12529-20ul 20 ul
EUR 183
SUMO1 Rabbit pAb
A12529-50ul 50 ul
EUR 223
SUMO1, human recombinant
4941-100
EUR 251
SUMO1, human recombinant
4941-1000
EUR 1518
Polyclonal SUMO1 Antibody
APR10341G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO1 . This antibody is tested and proven to work in the following applications:
SUMO1 Blocking Peptide
DF6853-BP 1mg
EUR 195
SUMO1 Blocking Peptide
20-abx063400
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
SUMO1-biotin Protein
E28001 50 µg
EUR 338.55
Description: fast delivery possible
Sumo1 Blocking Peptide
AF0280-BP 1mg
EUR 195
SUMO1 Conjugated Antibody
C32614 100ul
EUR 397
SUMO1 cloning plasmid
CSB-CL022948HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaat
  • Show more
Description: A cloning plasmid for the SUMO1 gene.
SUMO1 cloning plasmid
CSB-CL022948HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaat
  • Show more
Description: A cloning plasmid for the SUMO1 gene.
SUMO1 Rabbit mAb
A19121-100ul 100 ul
EUR 410
SUMO1 Rabbit mAb
A19121-200ul 200 ul
EUR 571
SUMO1 Rabbit mAb
A19121-20ul 20 ul
EUR 221
SUMO1 Rabbit mAb
A19121-50ul 50 ul
EUR 287
SUMO1 Rabbit pAb
A2130-100ul 100 ul
EUR 308
SUMO1 Rabbit pAb
A2130-200ul 200 ul
EUR 459
SUMO1 Rabbit pAb
A2130-20ul 20 ul
EUR 183
SUMO1 Rabbit pAb
A2130-50ul 50 ul
EUR 223
anti- SUMO1 antibody
FNab08389 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:50 - 1:200
  • Immunogen: SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
  • Uniprot ID: P63165
  • Gene ID: 7341
  • Research Area: Epigenetics, Cell Division and Proliferation, Cardiovascul
  • Show more
Description: Antibody raised against SUMO1
Anti-SUMO1 antibody
PAab08389 100 ug
EUR 386
p3*Flag- SUMO1
PVT10171 2 ug
EUR 301
pWPXLd-SUMO1 Plasmid
PVTB00039-4a 2 ug
EUR 356
Anti-SUMO1 antibody
STJ25747 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized.
Anti-SUMO1 antibody
STJ114403 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized.
Anti-SUMO1 antibody
STJ13100334 150 µl
EUR 427
Anti-SUMO1 antibody
STJ13100335 500 µg
EUR 427
Anti-SUMO1 antibody
STJ29819 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized.
SUMO1 protein (His tag)
80R-2035 100 ug
EUR 322
Description: Recombinant human SUMO1 protein (His tag)
SUMO1 ELISA KIT|Human
EF003360 96 Tests
EUR 689
Rat SUMO1 shRNA Plasmid
20-abx989125
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SUMO1 shRNA Plasmid
20-abx973294
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Sumo1 Cell ELISA Kit
abx595574-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Human SUMO1 shRNA Plasmid
20-abx955018
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUMO1 recombinant monoclonal antibody
A5175 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SUMO1 for WB, IHC, IF,ELISA
SUMO1 Human Recombinant Protein
PROTP63165 Regular: 50ug
EUR 317
Description: The active human SUMO-I (the 1-97 animo acid region of the Ubiquitin-like protein SMT3C precursor). The enzyme contains a single polypeptide band of 11 kDa. The predicted molecular weight of hSOMO I is 11 kDa. The The final fraction of enzyme contains single polypeptide band of approximately 20 kDa on SDS PAGE.
SUMO1 Recombinant Protein (Rat)
RP231725 100 ug Ask for price
pCMV-flag-Sumo1 Plasmid
PVTB00039-2a 2 ug
EUR 356
SUMO1 Recombinant Protein (Human)
RP030631 100 ug Ask for price
SUMO1 Recombinant Protein (Human)
RP030634 100 ug Ask for price
SUMO1 Recombinant Protein (Mouse)
RP176447 100 ug Ask for price
Polyclonal SUMO1 Antibody (N-term)
APR10343G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO1 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal SUMO1 Antibody (C-term)
APR10805G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO1 (C-term). This antibody is tested and proven to work in the following applications:
SUMO-1(SUMO1/1188) Antibody
BNUM1188-50 50uL
EUR 395
Description: Primary antibody against SUMO-1(SUMO1/1188), 1mg/mL

Back to top