TP53BP1

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
DLR-TP53BP1-Hu-96T 96T
EUR 673
  • Should the Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tumor Protein p53 Binding Protein 1 (TP53BP1) in samples from tissue homogenates or other biological fluids.
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RDR-TP53BP1-Hu-48Tests 48 Tests
EUR 544
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RDR-TP53BP1-Hu-96Tests 96 Tests
EUR 756
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RD-TP53BP1-Hu-48Tests 48 Tests
EUR 521
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RD-TP53BP1-Hu-96Tests 96 Tests
EUR 723
TP53BP1 Antibody
33021-100ul 100ul
EUR 252
TP53BP1 Antibody
1-CSB-PA000771
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TP53BP1 Antibody
1-CSB-PA060000
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
TP53BP1 Antibody
1-CSB-PA060001
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000
TP53BP1 Antibody
1-CSB-PA613268ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TP53BP1 Antibody
DF7472 200ul
EUR 304
Description: TP53BP1 Antibody detects endogenous levels of total TP53BP1.
TP53BP1 Antibody
CSB-PA572150-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
TP53BP1 Antibody
CSB-PA572150-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
TP53BP1 siRNA
20-abx937790
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TP53BP1 Antibody
ABD7472 100 ug
EUR 438
TP53BP1 Blocking Peptide
DF7472-BP 1mg
EUR 195
TP53BP1 antibody (Ser25)
70R-33534 100 ug
EUR 327
Description: Rabbit polyclonal TP53BP1 antibody (Ser25)
TP53BP1 Conjugated Antibody
C33021 100ul
EUR 397
TP53BP1 cloning plasmid
CSB-CL613268HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5919
  • Sequence: atggaccctactggaagtcagttggattcagatttctctcagcaagatactccttgcctgataattgaagattctcagcctgaaagccaggttctagaggatgattctggttctcacttcagtatgctatctcgacaccttcctaatctccagacgcacaaagaaaatcctgtgt
  • Show more
Description: A cloning plasmid for the TP53BP1 gene.
Anti-TP53BP1 antibody
STJ28324 100 µl
EUR 277
Phospho-TP53BP1 (S6) Antibody
1-CSB-PA050307
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TP53BP1 (S6). Recognizes Phospho-TP53BP1 (S6) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
Phospho-TP53BP1 (S25) Antibody
1-CSB-PA050308
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TP53BP1 (S25). Recognizes Phospho-TP53BP1 (S25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
TP53BP1 (Ab-29) Antibody
CSB-PA549522-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TP53BP1 (Ab-29). Recognizes TP53BP1 (Ab-29) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TP53BP1 (Ab-29) Antibody
CSB-PA549522-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TP53BP1 (Ab-29). Recognizes TP53BP1 (Ab-29) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
Phospho-TP53BP1 (Ser25) Antibody
CSB-PA019493-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TP53BP1 (Ser25). Recognizes Phospho-TP53BP1 (Ser25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500
Phospho-TP53BP1 (Ser25) Antibody
CSB-PA019493-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TP53BP1 (Ser25). Recognizes Phospho-TP53BP1 (Ser25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500
Human TP53BP1 shRNA Plasmid
20-abx954910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-53BP1/TP53BP1 Antibody
PA1976 100ug/vial
EUR 334
Phospho-TP53BP1-T543 Rabbit pAb
AP0861-100ul 100 ul
EUR 384
Phospho-TP53BP1-T543 Rabbit pAb
AP0861-200ul 200 ul
EUR 554
Phospho-TP53BP1-T543 Rabbit pAb
AP0861-20ul 20 ul
EUR 183
Phospho-TP53BP1-T543 Rabbit pAb
AP0861-50ul 50 ul
EUR 265
Monoclonal TP53BP1 Antibody, Clone: 6B3E10
AMM03119G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TP53BP1. The antibodies are raised in Mouse and are from clone 6B3E10. This antibody is applicable in WB and IHC, FC, E
Monoclonal TP53BP1 Antibody, Clone: 6B3E10
AMM03120G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TP53BP1. The antibodies are raised in Mouse and are from clone 6B3E10. This antibody is applicable in WB and IHC, FC, E
TP53BP1 ORF Vector (Human) (pORF)
ORF014798 1.0 ug DNA
EUR 659
Anti-Phospho-TP53BP1-T543 antibody
STJ11101002 100 µl
EUR 393
TP53BP1 ELISA Kit (Human) (OKAN04902)
OKAN04902 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that functions in the DNA double-strand break repair pathway choice, promoting non-homologous end joining (NHEJ) pathways, and limiting homologous recombination. This protein plays multiple roles in the DNA damage response, including promoting checkpoint signaling following DNA damage, acting as a scaffold for recruitment of DNA damage response proteins to damaged chromatin, and promoting NHEJ pathways by limiting end resection following a double-strand break. These roles are also important during V(D)J recombination, class switch recombination and at unprotected telomeres. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.138 ng/mL
TP53BP1 ELISA Kit (Human) (OKCD01016)
OKCD01016 96 Wells
EUR 831
Description: Description of target: Plays a key role in the response to DNA damage. May have a role in checkpoint signaling during mitosis. Enhances TP53-mediated transcriptional activation.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.10"53BP1, a mediator of the DNA damage checkpoint."_x005F_x005F_x000D_Wang B., Matsuoka S., Carpenter P.B., Elledge S.J._x005F_x005F_x000D_Science 298:1435-1438(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN DNA DAMAGE CHECKPOINT, INTERACTION WITH CHEK2.Ref.29"Protein phosphatase 5 is necessary for ATR-mediated DNA repair."_x005F_x005F_x000D_Kang Y., Cheong H.M., Lee J.H., Song P.I., Lee K.H., Kim S.Y., Jun J.Y., You H.J._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 404:476-481(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN DNA DAMAGE RESPONSE, PHOSPHORYLATION AT SER-1778, SUBCELLULAR LOCATION.Ref.40"Structural basis for the methylation state-specific recognition of histone H4-K20 by 53BP1 and Crb2 in DNA repair."_x005F_x005F_x000D_Botuyan M.V., Lee J., Ward I.M., Kim J.-E., Thompson J.R., Chen J., Mer G._x005F_x005F_x000D_Cell 127:1361-1373(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.25 ANGSTROMS) OF 1484-1603 IN COMPLEX WITH HISTONE H4, SUBUNIT, FUNCTION, MUTAGENESIS OF TRP-1495; TYR-1500; TYR-1502; ASP-1521 AND TYR-1523. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.138 ng/mL
Polyclonal TP53BP1 / 53BP1 Antibody (C-Terminus)
APR02427G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TP53BP1 / 53BP1 (C-Terminus). This antibody is tested and proven to work in the following applications:
TP53BP1 sgRNA CRISPR Lentivector set (Human)
K2426201 3 x 1.0 ug
EUR 339
Monoclonal TP53BP1 Antibody (monoclonal) (M01), Clone: 1B9
AMM04232G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TP53BP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in E
TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2426202 1.0 ug DNA
EUR 154
TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2426203 1.0 ug DNA
EUR 154
TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2426204 1.0 ug DNA
EUR 154
TP53BP1 Protein Vector (Human) (pPB-C-His)
PV059189 500 ng
EUR 3053
TP53BP1 Protein Vector (Human) (pPB-N-His)
PV059190 500 ng
EUR 3053
TP53BP1 Protein Vector (Human) (pPM-C-HA)
PV059191 500 ng
EUR 3053
TP53BP1 Protein Vector (Human) (pPM-C-His)
PV059192 500 ng
EUR 3053
TP53BP1 3'UTR GFP Stable Cell Line
TU076130 1.0 ml
EUR 2333
TP53BP1 3'UTR Luciferase Stable Cell Line
TU026130 1.0 ml
EUR 2333
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx016012-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx016013-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx004406
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx038165-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx129167
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx174990
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx320087
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx329149
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
abx330339-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
abx330778-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx323062
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx325367
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx000560
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Tumor Protein p53 Binding Protein 1 (TP53BP1)
4-RPH009Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12888
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.8kDa
  • Isoelectric Point: 5.5
Description: Recombinant Human Tumor Protein p53 Binding Protein 1 expressed in: E.coli
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) Protein
20-abx165869
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
20-abx153357
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
abx259260-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human TP53BP1(Tumor Protein p53 Binding Protein 1) ELISA Kit
EH4700 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Tumor suppressor p53- binding protein 1, TP53BP1 ELISA KIT
ELI-16943h 96 Tests
EUR 824
Mouse Tumor suppressor p53- binding protein 1, Tp53bp1 ELISA KIT
ELI-51941m 96 Tests
EUR 865
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) Protein (pS1778)
20-abx655869
  • EUR 481.00
  • EUR 244.00
  • EUR 1372.00
  • EUR 565.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Tumor Protein p53 Binding Protein 1 (TP53BP1) CLIA Kit
20-abx495350
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
TP53BP1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2426205 3 x 1.0 ug
EUR 376
Tumor Protein p53 Binding Protein 1 (TP53BP1) Polyclonal Antibody (Human)
4-PAH009Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TP53BP1 (Leu1724~Lys1964)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tumor Protein p53 Binding Protein 1 (TP53BP1)
Human Tumor Protein p53 Binding Protein 1 ELISA Kit (TP53BP1)
RK02431 96 Tests
EUR 521

Back to top