TP53BP1

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
DLR-TP53BP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tumor Protein p53 Binding Protein 1 (TP53BP1) in samples from tissue homogenates or other biological fluids.

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RDR-TP53BP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RDR-TP53BP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RD-TP53BP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
RD-TP53BP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

TP53BP1 Antibody
33021-100ul	SAB	100ul	EUR 252

TP53BP1 Antibody
1-CSB-PA000771	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

TP53BP1 Antibody
1-CSB-PA060000	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TP53BP1 Antibody
1-CSB-PA060001	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TP53BP1 Antibody
1-CSB-PA613268ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TP53BP1 Antibody
DF7472	Affbiotech	200ul	EUR 304
Description: TP53BP1 Antibody detects endogenous levels of total TP53BP1.

TP53BP1 Antibody
CSB-PA572150-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TP53BP1 Antibody
CSB-PA572150-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TP53BP1. Recognizes TP53BP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TP53BP1 siRNA
20-abx937790	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TP53BP1 Antibody
ABD7472	Lifescience Market	100 ug	EUR 438

TP53BP1 Blocking Peptide
DF7472-BP	Affbiotech	1mg	EUR 195

TP53BP1 antibody (Ser25)
70R-33534	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TP53BP1 antibody (Ser25)

TP53BP1 Conjugated Antibody
C33021	SAB	100ul	EUR 397

TP53BP1 cloning plasmid
CSB-CL613268HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5919 Sequence: atggaccctactggaagtcagttggattcagatttctctcagcaagatactccttgcctgataattgaagattctcagcctgaaagccaggttctagaggatgattctggttctcacttcagtatgctatctcgacaccttcctaatctccagacgcacaaagaaaatcctgtgt Show more
Description: A cloning plasmid for the TP53BP1 gene.

Anti-TP53BP1 antibody
STJ28324	St John's Laboratory	100 µl	EUR 277

Phospho-TP53BP1 (S6) Antibody
1-CSB-PA050307	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TP53BP1 (S6). Recognizes Phospho-TP53BP1 (S6) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Phospho-TP53BP1 (S25) Antibody
1-CSB-PA050308	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TP53BP1 (S25). Recognizes Phospho-TP53BP1 (S25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

TP53BP1 (Ab-29) Antibody
CSB-PA549522-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TP53BP1 (Ab-29). Recognizes TP53BP1 (Ab-29) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TP53BP1 (Ab-29) Antibody
CSB-PA549522-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TP53BP1 (Ab-29). Recognizes TP53BP1 (Ab-29) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-TP53BP1 (Ser25) Antibody
CSB-PA019493-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-TP53BP1 (Ser25). Recognizes Phospho-TP53BP1 (Ser25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

Phospho-TP53BP1 (Ser25) Antibody
CSB-PA019493-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-TP53BP1 (Ser25). Recognizes Phospho-TP53BP1 (Ser25) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500

Human TP53BP1 shRNA Plasmid
20-abx954910	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-53BP1/TP53BP1 Antibody
PA1976	BosterBio	100ug/vial	EUR 334

Phospho-TP53BP1-T543 Rabbit pAb
AP0861-100ul	Abclonal	100 ul	EUR 384

Phospho-TP53BP1-T543 Rabbit pAb
AP0861-200ul	Abclonal	200 ul	EUR 554

Phospho-TP53BP1-T543 Rabbit pAb
AP0861-20ul	Abclonal	20 ul	EUR 183

Phospho-TP53BP1-T543 Rabbit pAb
AP0861-50ul	Abclonal	50 ul	EUR 265

Monoclonal TP53BP1 Antibody, Clone: 6B3E10
AMM03119G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human TP53BP1. The antibodies are raised in Mouse and are from clone 6B3E10. This antibody is applicable in WB and IHC, FC, E

Monoclonal TP53BP1 Antibody, Clone: 6B3E10
AMM03120G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human TP53BP1. The antibodies are raised in Mouse and are from clone 6B3E10. This antibody is applicable in WB and IHC, FC, E

TP53BP1 ORF Vector (Human) (pORF)
ORF014798	ABM	1.0 ug DNA	EUR 659

Anti-Phospho-TP53BP1-T543 antibody
STJ11101002	St John's Laboratory	100 µl	EUR 393

TP53BP1 ELISA Kit (Human) (OKAN04902)
OKAN04902	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein that functions in the DNA double-strand break repair pathway choice, promoting non-homologous end joining (NHEJ) pathways, and limiting homologous recombination. This protein plays multiple roles in the DNA damage response, including promoting checkpoint signaling following DNA damage, acting as a scaffold for recruitment of DNA damage response proteins to damaged chromatin, and promoting NHEJ pathways by limiting end resection following a double-strand break. These roles are also important during V(D)J recombination, class switch recombination and at unprotected telomeres. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.138 ng/mL

TP53BP1 ELISA Kit (Human) (OKCD01016)
OKCD01016	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Plays a key role in the response to DNA damage. May have a role in checkpoint signaling during mitosis. Enhances TP53-mediated transcriptional activation.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.10"53BP1, a mediator of the DNA damage checkpoint."_x005F_x005F_x000D_Wang B., Matsuoka S., Carpenter P.B., Elledge S.J._x005F_x005F_x000D_Science 298:1435-1438(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN DNA DAMAGE CHECKPOINT, INTERACTION WITH CHEK2.Ref.29"Protein phosphatase 5 is necessary for ATR-mediated DNA repair."_x005F_x005F_x000D_Kang Y., Cheong H.M., Lee J.H., Song P.I., Lee K.H., Kim S.Y., Jun J.Y., You H.J._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 404:476-481(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN DNA DAMAGE RESPONSE, PHOSPHORYLATION AT SER-1778, SUBCELLULAR LOCATION.Ref.40"Structural basis for the methylation state-specific recognition of histone H4-K20 by 53BP1 and Crb2 in DNA repair."_x005F_x005F_x000D_Botuyan M.V., Lee J., Ward I.M., Kim J.-E., Thompson J.R., Chen J., Mer G._x005F_x005F_x000D_Cell 127:1361-1373(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.25 ANGSTROMS) OF 1484-1603 IN COMPLEX WITH HISTONE H4, SUBUNIT, FUNCTION, MUTAGENESIS OF TRP-1495; TYR-1500; TYR-1502; ASP-1521 AND TYR-1523. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.138 ng/mL

Polyclonal TP53BP1 / 53BP1 Antibody (C-Terminus)
APR02427G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TP53BP1 / 53BP1 (C-Terminus). This antibody is tested and proven to work in the following applications:

TP53BP1 sgRNA CRISPR Lentivector set (Human)
K2426201	ABM	3 x 1.0 ug	EUR 339

Monoclonal TP53BP1 Antibody (monoclonal) (M01), Clone: 1B9
AMM04232G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TP53BP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in E

TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2426202	ABM	1.0 ug DNA	EUR 154

TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2426203	ABM	1.0 ug DNA	EUR 154

TP53BP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2426204	ABM	1.0 ug DNA	EUR 154

TP53BP1 Protein Vector (Human) (pPB-C-His)
PV059189	ABM	500 ng	EUR 3053

TP53BP1 Protein Vector (Human) (pPB-N-His)
PV059190	ABM	500 ng	EUR 3053

TP53BP1 Protein Vector (Human) (pPM-C-HA)
PV059191	ABM	500 ng	EUR 3053

TP53BP1 Protein Vector (Human) (pPM-C-His)
PV059192	ABM	500 ng	EUR 3053

TP53BP1 3'UTR GFP Stable Cell Line
TU076130	ABM	1.0 ml	EUR 2333

TP53BP1 3'UTR Luciferase Stable Cell Line
TU026130	ABM	1.0 ml	EUR 2333

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx016012-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx016013-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx004406	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
abx038165-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx129167	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx174990	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx320087	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx329149	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
abx330339-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
abx330778-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx323062	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tumor Protein p53 Binding Protein 1 (TP53BP1) Antibody
20-abx325367	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tumor Protein P53 Binding Protein 1 (TP53BP1) Antibody
20-abx000560	Abbexa	EUR 592.00 EUR 857.00 EUR 411.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Recombinant Tumor Protein p53 Binding Protein 1 (TP53BP1)
4-RPH009Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q12888 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.8kDa Isoelectric Point: 5.5
Description: Recombinant Human Tumor Protein p53 Binding Protein 1 expressed in: E.coli

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) Protein
20-abx165869	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
20-abx153357	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) ELISA Kit
abx259260-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human TP53BP1(Tumor Protein p53 Binding Protein 1) ELISA Kit
EH4700	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Tumor suppressor p53- binding protein 1, TP53BP1 ELISA KIT
ELI-16943h	Lifescience Market	96 Tests	EUR 824

Mouse Tumor suppressor p53- binding protein 1, Tp53bp1 ELISA KIT
ELI-51941m	Lifescience Market	96 Tests	EUR 865

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) Protein (pS1778)
20-abx655869	Abbexa	EUR 481.00 EUR 244.00 EUR 1372.00 EUR 565.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Tumor Protein p53 Binding Protein 1 (TP53BP1) CLIA Kit
20-abx495350	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

TP53BP1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2426205	ABM	3 x 1.0 ug	EUR 376

Tumor Protein p53 Binding Protein 1 (TP53BP1) Polyclonal Antibody (Human)
4-PAH009Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TP53BP1 (Leu1724~Lys1964) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tumor Protein p53 Binding Protein 1 (TP53BP1)

Human Tumor Protein p53 Binding Protein 1 ELISA Kit (TP53BP1)
RK02431	Abclonal	96 Tests	EUR 521