USP5

USP5 antibody
10R-6248 100 ul
EUR 691
Description: Mouse monoclonal USP5 antibody
USP5 antibody
10R-6249 100 ul
EUR 691
Description: Mouse monoclonal USP5 antibody
USP5 antibody
10R-6250 100 ul
EUR 691
Description: Mouse monoclonal USP5 antibody
USP5 antibody
10R-6251 100 ul
EUR 726
Description: Mouse monoclonal USP5 antibody
USP5 Antibody
6132-50
EUR 207
USP5 Antibody
42820-100ul 100ul
EUR 252
USP5 Antibody
39748-100ul 100ul
EUR 390
USP5 Antibody
1-CSB-PA075147
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
USP5 Antibody
1-CSB-PA032081
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
USP5 Antibody
1-CSB-PA025742GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
USP5 Antibody
1-CSB-PA025742LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
USP5 siRNA
20-abx939256
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP5 siRNA
20-abx939257
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-USP5
YF-PA25043 50 ul
EUR 334
Description: Mouse polyclonal to USP5
Polyclonal USP5 Antibody
APC00003G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human USP5 . This antibody is tested and proven to work in the following applications:
USP5 Conjugated Antibody
C42820 100ul
EUR 397
USP5 cloning plasmid
CSB-CL025742HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2508
  • Sequence: atggcggagctgagtgaggaggcgctgctgtcagtattaccgacgatccgggtccctaaggctggagaccgggtccacaaagacgagtgcgccttctccttcgacacgccggagtctgaggggggcctctacatctgtatgaacacgtttctgggctttgggaaacagtatgtgg
  • Show more
Description: A cloning plasmid for the USP5 gene.
USP5 Rabbit pAb
A4202-100ul 100 ul
EUR 308
USP5 Rabbit pAb
A4202-200ul 200 ul
EUR 459
USP5 Rabbit pAb
A4202-20ul 20 ul
EUR 183
USP5 Rabbit pAb
A4202-50ul 50 ul
EUR 223
USP5 Polyclonal Antibody
A63772 100 µg
EUR 570.55
Description: reagents widely cited
anti- USP5 antibody
FNab09339 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • Immunogen: ubiquitin specific peptidase 5(isopeptidase T)
  • Uniprot ID: P45974
  • Gene ID: 8078
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP5
anti- USP5 antibody
FNab09340 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:2000
  • Immunogen: ubiquitin specific peptidase 5(isopeptidase T)
  • Uniprot ID: P45974
  • Gene ID: 8078
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP5
anti- USP5 antibody
FNab09341 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: ubiquitin specific peptidase 5(isopeptidase T)
  • Uniprot ID: P45974
  • Gene ID: 8078
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP5
Anti-USP5 antibody
PAab09339 100 ug
EUR 386
Anti-USP5 antibody
STJ26063 100 µl
EUR 277
Anti-USP5 (2C8)
YF-MA16279 100 ug
EUR 363
Description: Mouse monoclonal to USP5
Anti-USP5 (4G4)
YF-MA16280 100 ug
EUR 363
Description: Mouse monoclonal to USP5
USP5 Antibody, HRP conjugated
1-CSB-PA025742LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP5 Antibody, FITC conjugated
1-CSB-PA025742LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP5 Antibody, Biotin conjugated
1-CSB-PA025742LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP5. Recognizes USP5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP5 ELISA KIT|Human
EF004147 96 Tests
EUR 689
Mouse USP5 shRNA Plasmid
20-abx973299
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP5 shRNA Plasmid
20-abx955359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal USP5 Antibody (N-term)
APR04807G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP5 (N-term). This antibody is tested and proven to work in the following applications:
Monoclonal USP5 Antibody, Clone: 1340CT704.170.140
AMM02502G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP5. The antibodies are raised in Mouse and are from clone 1340CT704.170.140. This antibody is applicable in WB, E
USP5 Polyclonal Antibody, HRP Conjugated
A63773 100 µg
EUR 570.55
Description: Ask the seller for details
USP5 Polyclonal Antibody, FITC Conjugated
A63774 100 µg
EUR 570.55
Description: The best epigenetics products
USP5 Polyclonal Antibody, Biotin Conjugated
A63775 100 µg
EUR 570.55
Description: kits suitable for this type of research
Usp5 ORF Vector (Mouse) (pORF)
ORF061161 1.0 ug DNA
EUR 506
Usp5 ORF Vector (Rat) (pORF)
ORF078714 1.0 ug DNA
EUR 506
USP5 ORF Vector (Human) (pORF)
ORF011385 1.0 ug DNA
EUR 95
Ubiquitin Specific Peptidase 5 (USP5) Antibody
20-abx003110
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin specific peptidase 5 (USP5) Antibody
20-abx212708
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin specific peptidase 5 (USP5) Antibody
20-abx212709
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
abx036192-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
abx031543-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
abx031543-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
abx239339-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
abx239341-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody
20-abx318550
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Usp5 sgRNA CRISPR Lentivector set (Rat)
K6549801 3 x 1.0 ug
EUR 339
USP5 sgRNA CRISPR Lentivector set (Human)
K2596301 3 x 1.0 ug
EUR 339
Usp5 sgRNA CRISPR Lentivector set (Mouse)
K4693601 3 x 1.0 ug
EUR 339
Ubiquitin Specific Peptidase 5 (USP5) Antibody (HRP)
20-abx305908
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody (FITC)
20-abx305909
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 5 (USP5) Antibody (Biotin)
20-abx305910
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Monoclonal USP5 Antibody (monoclonal) (M01), Clone: 2C8
AMM04303G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human USP5 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C8. This antibody is applicable in WB, E
Usp5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6549802 1.0 ug DNA
EUR 154
Usp5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6549803 1.0 ug DNA
EUR 154
Usp5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6549804 1.0 ug DNA
EUR 154
USP5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2596302 1.0 ug DNA
EUR 154
USP5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2596303 1.0 ug DNA
EUR 154
USP5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2596304 1.0 ug DNA
EUR 154
Usp5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4693602 1.0 ug DNA
EUR 154
Usp5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4693603 1.0 ug DNA
EUR 154
Usp5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4693604 1.0 ug DNA
EUR 154
USP5 Protein Vector (Mouse) (pPB-C-His)
PV244642 500 ng
EUR 1065
USP5 Protein Vector (Mouse) (pPB-N-His)
PV244643 500 ng
EUR 1065
USP5 Protein Vector (Mouse) (pPM-C-HA)
PV244644 500 ng
EUR 1065
USP5 Protein Vector (Mouse) (pPM-C-His)
PV244645 500 ng
EUR 1065
USP5 Protein Vector (Rat) (pPB-C-His)
PV314854 500 ng
EUR 1166
USP5 Protein Vector (Rat) (pPB-N-His)
PV314855 500 ng
EUR 1166
USP5 Protein Vector (Rat) (pPM-C-HA)
PV314856 500 ng
EUR 1166

Back to top