VAMP2

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
DLR-VAMP2-Hu-96T 96T
EUR 673
  • Should the Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vesicle Associated Membrane Protein 2 (VAMP2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RDR-VAMP2-Hu-48Tests 48 Tests
EUR 544
Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RDR-VAMP2-Hu-96Tests 96 Tests
EUR 756
Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RD-VAMP2-Hu-48Tests 48 Tests
EUR 521
Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RD-VAMP2-Hu-96Tests 96 Tests
EUR 723
Vamp2/ Rat Vamp2 ELISA Kit
ELI-28857r 96 Tests
EUR 886
VAMP2 antibody
70R-21230 50 ul
EUR 435
Description: Rabbit polyclonal VAMP2 antibody
VAMP2 antibody
38228-100ul 100ul
EUR 252
VAMP2 Antibody
49463-100ul 100ul
EUR 333
VAMP2 Antibody
49463-50ul 50ul
EUR 239
VAMP2 Antibody
43179-100ul 100ul
EUR 252
VAMP2 Antibody
1-CSB-PA055935
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
VAMP2 Antibody
DF6381 200ul
EUR 304
Description: VAMP2 Antibody detects endogenous levels of total VAMP2.
VAMP2 Antibody
1-CSB-PA273818
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
VAMP2 Antibody
1-CSB-PA025781ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
VAMP2 Antibody
1-CSB-PA025781GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
VAMP2 siRNA
20-abx905999
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VAMP2 siRNA
20-abx939312
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VAMP2 siRNA
20-abx939313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VAMP2 Antibody
ABD6381 100 ug
EUR 438
VAMP2 Rabbit pAb
A1249-100ul 100 ul
EUR 308
VAMP2 Rabbit pAb
A1249-200ul 200 ul
EUR 459
VAMP2 Rabbit pAb
A1249-20ul 20 ul
EUR 183
VAMP2 Rabbit pAb
A1249-50ul 50 ul
EUR 223
VAMP2 Blocking Peptide
DF6381-BP 1mg
EUR 195
Anti-VAMP2 Antibody
A02331 200ug/vial
EUR 455
Description: Rabbit Polyclonal VAMP2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
VAMP2 Conjugated Antibody
C49463 100ul
EUR 397
VAMP2 Conjugated Antibody
C43179 100ul
EUR 397
VAMP2 Conjugated Antibody
C38228 100ul
EUR 397
VAMP2 cloning plasmid
CSB-CL025781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atgtctgctaccgctgccacggccccccctgctgccccggctggggagggtggtccccctgcaccccctccaaacctcaccagtaacaggagactgcagcagacccaggcccaggtggatgaggtggtggacatcatgagggtgaacgtggacaaggtcctggagcgagaccagaa
  • Show more
Description: A cloning plasmid for the VAMP2 gene.
VAMP2 Rabbit mAb
A4235-100ul 100 ul
EUR 410
VAMP2 Rabbit mAb
A4235-200ul 200 ul
EUR 571
VAMP2 Rabbit mAb
A4235-20ul 20 ul
EUR 221
VAMP2 Rabbit mAb
A4235-50ul 50 ul
EUR 287
anti- VAMP2 antibody
FNab09359 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: vesicle-associated membrane protein 2(synaptobrevin 2)
  • Uniprot ID: P63027
  • Gene ID: 6844
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against VAMP2
Anti-VAMP2 antibody
PAab09359 100 ug
EUR 386
Anti-VAMP2 antibody
STJ26068 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG.
VAMP1/VAMP2/VAMP3 Antibody
1-CSB-PA050186
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VAMP1/VAMP2/VAMP3. Recognizes VAMP1/VAMP2/VAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
VAMP2 ELISA KIT|Human
EF004164 96 Tests
EUR 689
Mouse VAMP2 shRNA Plasmid
20-abx973344
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat VAMP2 shRNA Plasmid
20-abx984649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VAMP1 / VAMP2 / VAMP3 Antibody
20-abx326473
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human VAMP2 shRNA Plasmid
20-abx954680
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VAMP2 recombinant monoclonal antibody
A5896 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human VAMP2 for WB, IF,ELISA
VAMP2 Recombinant Protein (Rat)
RP236243 100 ug Ask for price
VAMP2 Recombinant Protein (Human)
RP034204 100 ug Ask for price
VAMP2 Recombinant Protein (Mouse)
RP183608 100 ug Ask for price
Anti-VAMP2 Antibody (Monoclonal, SP10)
M02331 100ul/vial
EUR 397
Description: Mouse Monoclonal VAMP2 Antibody (Monoclonal, SP10). Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-VAMP2 Rabbit Monoclonal Antibody
M02331-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal VAMP2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Vamp2 ORF Vector (Mouse) (pORF)
ORF061204 1.0 ug DNA
EUR 506
Vamp2 ORF Vector (Rat) (pORF)
ORF078749 1.0 ug DNA
EUR 506
VAMP2 ORF Vector (Human) (pORF)
ORF011402 1.0 ug DNA
EUR 95
VAMP2 ELISA Kit (Human) (OKCA00856)
OKCA00856 96 Wells
EUR 833
Description: Description of target: Involved in the targeting and/or fusion of transport vesicles to their target membrane. Modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.68 pg/mL
VAMP2 ELISA Kit (Human) (OKCD08812)
OKCD08812 96 Wells
EUR 975
Description: Description of target: Synaptobrevin 2 which is an 18 kDa integral membrane protein localized to the cytoplasmic surface of synaptic vesicle, consists of a proline-rich N-terminal region, a highly conserved hydrophilic domain, followed by a transmembrane anchor and a C-terminal. Synaptobrevin 2 is predominantly expressed in Langerhans islets and glomerular cells. The N-terminal domain of the protein (residues 1-89) forms a specific SNARE complex with the target membrane-associated t- or Q-SNAREs syntaxin 1 and SNAP-25.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
VAMP2 ELISA Kit (Human) (OKDD00589)
OKDD00589 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL
Vamp2 sgRNA CRISPR Lentivector set (Rat)
K7556001 3 x 1.0 ug
EUR 339
VAMP2 sgRNA CRISPR Lentivector set (Human)
K2604501 3 x 1.0 ug
EUR 339
Vamp2 sgRNA CRISPR Lentivector set (Mouse)
K4393701 3 x 1.0 ug
EUR 339
VAMP2 Synaptobrevin-2 Human Recombinant Protein
PROTP63027 Regular: 20ug
EUR 317
Description: VAMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 126 amino acids (1-89) and having a molecular mass of 13.8 kDa. The VAMP contains 37 amino acids His-Tag fused at N-terminus and purified by standard chromatography techniques.
VAMP2 Synaptobrevin-2 Recombinant Protein Mouse
PROTP63044 Regular: 5ug
EUR 317
Description: VAMP2 Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 118 amino acids (1-94 a.a) and having a molecular mass of 12.8kDa. VAMP2 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Vesicle-associated membrane protein 2 (VAMP2)
1-CSB-EP025781HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Vesicle-associated membrane protein 2(VAMP2) expressed in E.coli
Rat Vesicle-associated membrane protein 2 (Vamp2)
1-CSB-EP025781RA1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Vesicle-associated membrane protein 2(Vamp2),partial expressed in E.coli
Polyclonal VAMP2 / VAMP-2 Antibody (aa1-66)
APR10686G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VAMP2 / VAMP-2 (aa1-66). This antibody is tested and proven to work in the following applications:
Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx178867
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx116606
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx175088
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
abx239359-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
abx239360-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx242013
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx242014
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx320537
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx001161
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7556002 1.0 ug DNA
EUR 154
Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7556003 1.0 ug DNA
EUR 154
Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7556004 1.0 ug DNA
EUR 154

Back to top