VAMP2

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
DLR-VAMP2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vesicle Associated Membrane Protein 2 (VAMP2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RDR-VAMP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RDR-VAMP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RD-VAMP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Vesicle Associated Membrane Protein 2 (VAMP2) ELISA Kit
RD-VAMP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Vamp2/ Rat Vamp2 ELISA Kit
ELI-28857r	Lifescience Market	96 Tests	EUR 886

VAMP2 antibody
70R-21230	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VAMP2 antibody

VAMP2 antibody
38228-100ul	SAB	100ul	EUR 252

VAMP2 Antibody
49463-100ul	SAB	100ul	EUR 333

VAMP2 Antibody
49463-50ul	SAB	50ul	EUR 239

VAMP2 Antibody
43179-100ul	SAB	100ul	EUR 252

VAMP2 Antibody
1-CSB-PA055935	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VAMP2 Antibody
DF6381	Affbiotech	200ul	EUR 304
Description: VAMP2 Antibody detects endogenous levels of total VAMP2.

VAMP2 Antibody
1-CSB-PA273818	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VAMP2 Antibody
1-CSB-PA025781ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VAMP2 Antibody
1-CSB-PA025781GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP2. Recognizes VAMP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

VAMP2 siRNA
20-abx905999	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP2 siRNA
20-abx939312	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP2 siRNA
20-abx939313	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP2 Antibody
ABD6381	Lifescience Market	100 ug	EUR 438

VAMP2 Rabbit pAb
A1249-100ul	Abclonal	100 ul	EUR 308

VAMP2 Rabbit pAb
A1249-200ul	Abclonal	200 ul	EUR 459

VAMP2 Rabbit pAb
A1249-20ul	Abclonal	20 ul	EUR 183

VAMP2 Rabbit pAb
A1249-50ul	Abclonal	50 ul	EUR 223

VAMP2 Blocking Peptide
DF6381-BP	Affbiotech	1mg	EUR 195

Anti-VAMP2 Antibody
A02331	BosterBio	200ug/vial	EUR 455
Description: Rabbit Polyclonal VAMP2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

VAMP2 Conjugated Antibody
C49463	SAB	100ul	EUR 397

VAMP2 Conjugated Antibody
C43179	SAB	100ul	EUR 397

VAMP2 Conjugated Antibody
C38228	SAB	100ul	EUR 397

VAMP2 cloning plasmid
CSB-CL025781HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 351 Sequence: atgtctgctaccgctgccacggccccccctgctgccccggctggggagggtggtccccctgcaccccctccaaacctcaccagtaacaggagactgcagcagacccaggcccaggtggatgaggtggtggacatcatgagggtgaacgtggacaaggtcctggagcgagaccagaa Show more
Description: A cloning plasmid for the VAMP2 gene.

VAMP2 Rabbit mAb
A4235-100ul	Abclonal	100 ul	EUR 410

VAMP2 Rabbit mAb
A4235-200ul	Abclonal	200 ul	EUR 571

VAMP2 Rabbit mAb
A4235-20ul	Abclonal	20 ul	EUR 221

VAMP2 Rabbit mAb
A4235-50ul	Abclonal	50 ul	EUR 287

anti- VAMP2 antibody
FNab09359	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: vesicle-associated membrane protein 2(synaptobrevin 2) Uniprot ID: P63027 Gene ID: 6844 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against VAMP2

Anti-VAMP2 antibody
PAab09359	Lifescience Market	100 ug	EUR 386

Anti-VAMP2 antibody
STJ26068	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG.

VAMP1/VAMP2/VAMP3 Antibody
1-CSB-PA050186	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VAMP1/VAMP2/VAMP3. Recognizes VAMP1/VAMP2/VAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

VAMP2 ELISA KIT|Human
EF004164	Lifescience Market	96 Tests	EUR 689

Mouse VAMP2 shRNA Plasmid
20-abx973344	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat VAMP2 shRNA Plasmid
20-abx984649	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

VAMP1 / VAMP2 / VAMP3 Antibody
20-abx326473	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human VAMP2 shRNA Plasmid
20-abx954680	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

VAMP2 recombinant monoclonal antibody
A5896	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human VAMP2 for WB, IF,ELISA

VAMP2 Recombinant Protein (Rat)
RP236243	ABM	100 ug	Ask for price

VAMP2 Recombinant Protein (Human)
RP034204	ABM	100 ug	Ask for price

VAMP2 Recombinant Protein (Mouse)
RP183608	ABM	100 ug	Ask for price

Anti-VAMP2 Antibody (Monoclonal, SP10)
M02331	BosterBio	100ul/vial	EUR 397
Description: Mouse Monoclonal VAMP2 Antibody (Monoclonal, SP10). Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-VAMP2 Rabbit Monoclonal Antibody
M02331-1	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal VAMP2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Vamp2 ORF Vector (Mouse) (pORF)
ORF061204	ABM	1.0 ug DNA	EUR 506

Vamp2 ORF Vector (Rat) (pORF)
ORF078749	ABM	1.0 ug DNA	EUR 506

VAMP2 ORF Vector (Human) (pORF)
ORF011402	ABM	1.0 ug DNA	EUR 95

VAMP2 ELISA Kit (Human) (OKCA00856)
OKCA00856	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Involved in the targeting and/or fusion of transport vesicles to their target membrane. Modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.68 pg/mL

VAMP2 ELISA Kit (Human) (OKCD08812)
OKCD08812	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Synaptobrevin 2 which is an 18 kDa integral membrane protein localized to the cytoplasmic surface of synaptic vesicle, consists of a proline-rich N-terminal region, a highly conserved hydrophilic domain, followed by a transmembrane anchor and a C-terminal. Synaptobrevin 2 is predominantly expressed in Langerhans islets and glomerular cells. The N-terminal domain of the protein (residues 1-89) forms a specific SNARE complex with the target membrane-associated t- or Q-SNAREs syntaxin 1 and SNAP-25.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

VAMP2 ELISA Kit (Human) (OKDD00589)
OKDD00589	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Vamp2 sgRNA CRISPR Lentivector set (Rat)
K7556001	ABM	3 x 1.0 ug	EUR 339

VAMP2 sgRNA CRISPR Lentivector set (Human)
K2604501	ABM	3 x 1.0 ug	EUR 339

Vamp2 sgRNA CRISPR Lentivector set (Mouse)
K4393701	ABM	3 x 1.0 ug	EUR 339

VAMP2 Synaptobrevin-2 Human Recombinant Protein
PROTP63027	BosterBio	Regular: 20ug	EUR 317
Description: VAMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 126 amino acids (1-89) and having a molecular mass of 13.8 kDa. The VAMP contains 37 amino acids His-Tag fused at N-terminus and purified by standard chromatography techniques.

VAMP2 Synaptobrevin-2 Recombinant Protein Mouse
PROTP63044	BosterBio	Regular: 5ug	EUR 317
Description: VAMP2 Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 118 amino acids (1-94 a.a) and having a molecular mass of 12.8kDa. VAMP2 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Vesicle-associated membrane protein 2 (VAMP2)
1-CSB-EP025781HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Vesicle-associated membrane protein 2(VAMP2) expressed in E.coli

Rat Vesicle-associated membrane protein 2 (Vamp2)
1-CSB-EP025781RA1	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 14.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Vesicle-associated membrane protein 2(Vamp2),partial expressed in E.coli

Polyclonal VAMP2 / VAMP-2 Antibody (aa1-66)
APR10686G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VAMP2 / VAMP-2 (aa1-66). This antibody is tested and proven to work in the following applications:

Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx178867	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx116606	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx175088	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
abx239359-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
abx239360-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx242013	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Vesicle Associated Membrane Protein 2 (VAMP2) Antibody
20-abx242014	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx320537	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Vesicle-Associated Membrane Protein 2 (VAMP2) Antibody
20-abx001161	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7556002	ABM	1.0 ug DNA	EUR 154

Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7556003	ABM	1.0 ug DNA	EUR 154

Vamp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7556004	ABM	1.0 ug DNA	EUR 154