VBP1

VBP1 antibody
70R-13622 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal VBP1 antibody
VBP1 antibody
70R-21244 50 ul
EUR 435
Description: Rabbit polyclonal VBP1 antibody
VBP1 Antibody
1-CSB-PA025808GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VBP1. Recognizes VBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
VBP1 siRNA
20-abx939358
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VBP1 siRNA
20-abx939359
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VBP1 Polyclonal Antibody
31653-100ul 100ul
EUR 252
VBP1 Polyclonal Antibody
31653-50ul 50ul
EUR 187
VBP1 cloning plasmid
CSB-CL025808HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 594
  • Sequence: atggcggccgttaaggacagttgtggcaaaggagaaatggccacagggaatgggcggcggctccacctggggattcctgaggccgtgtttgtggaagatgtagattccttcatgaaacagcctgggaatgagactgcagatacagtattaaagaagctggatgaacagtaccagaa
  • Show more
Description: A cloning plasmid for the VBP1 gene.
VBP1 Rabbit pAb
A8990-100ul 100 ul
EUR 308
VBP1 Rabbit pAb
A8990-200ul 200 ul
EUR 459
VBP1 Rabbit pAb
A8990-20ul 20 ul
EUR 183
VBP1 Rabbit pAb
A8990-50ul 50 ul
EUR 223
anti- VBP1 antibody
FNab09379 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:20-1:200
  • Immunogen: von Hippel-Lindau binding protein 1
  • Uniprot ID: P61758
  • Gene ID: 7411
  • Research Area: Metabolism
Description: Antibody raised against VBP1
Anti-VBP1 antibody
PAab09379 100 ug
EUR 386
Anti-VBP1 antibody
STJ111509 100 µl
EUR 277
Description: The protein encoded by this gene interacts with the Von Hippel-Lindau protein to form an intracellular complex. The encoded protein functions as a chaperone protein, and may play a role in the transport of the Von Hippel-Lindau protein from the perinuclear granules to the nucleus or cytoplasm. Alternative splicing and the use of alternate transcription start sites results in multiple transcript variants encoding different protein isoforms.
VBP1 protein (His tag)
30R-2925 100 ug
EUR 322
Description: Purified recombinant Human VBP1 protein (His tag)
VBP1 ELISA KIT|Human
EF004182 96 Tests
EUR 689
Mouse VBP1 shRNA Plasmid
20-abx973352
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VBP1 Polyclonal Conjugated Antibody
C31653 100ul
EUR 397
Human VBP1 shRNA Plasmid
20-abx955070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VBP1 Recombinant Protein (Human)
RP034276 100 ug Ask for price
VBP1 Recombinant Protein (Mouse)
RP183692 100 ug Ask for price
Prefoldin Subunit 3 (VBP1) Protein
20-abx260998
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Vbp1 ORF Vector (Mouse) (pORF)
ORF061232 1.0 ug DNA
EUR 506
VBP1 ORF Vector (Human) (pORF)
ORF011426 1.0 ug DNA
EUR 95
pECMV-Vbp1-m-FLAG Plasmid
PVT15511 2 ug
EUR 325
VBP1 sgRNA CRISPR Lentivector set (Human)
K2606801 3 x 1.0 ug
EUR 339
Vbp1 sgRNA CRISPR Lentivector set (Mouse)
K3409501 3 x 1.0 ug
EUR 339
Monoclonal VBP1 Antibody (monoclonal) (M01), Clone: 3D11
AMM08461G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human VBP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3D11. This antibody is applicable in WB and IHC, E
Rabbit Prefoldin subunit 3(VBP1) ELISA kit
E04P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Prefoldin subunit 3(VBP1) ELISA kit
E04P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Prefoldin subunit 3(VBP1) ELISA kit
E04P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Prefoldin subunit 3(VBP1) ELISA kit
E02P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Prefoldin subunit 3(VBP1) ELISA kit
E02P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Prefoldin subunit 3(VBP1) ELISA kit
E02P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Prefoldin subunit 3(VBP1) ELISA kit
E03P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Prefoldin subunit 3(VBP1) ELISA kit
E03P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Prefoldin subunit 3(VBP1) ELISA kit
E03P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prefoldin subunit 3(VBP1) ELISA kit
E01P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prefoldin subunit 3(VBP1) ELISA kit
E01P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prefoldin subunit 3(VBP1) ELISA kit
E01P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Prefoldin subunit 3(VBP1) ELISA kit
E06P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Prefoldin subunit 3(VBP1) ELISA kit
E06P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Prefoldin subunit 3(VBP1) ELISA kit
E06P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Prefoldin subunit 3(VBP1) ELISA kit
E08P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Prefoldin subunit 3(VBP1) ELISA kit
E08P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Prefoldin subunit 3(VBP1) ELISA kit
E08P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Prefoldin subunit 3(VBP1) ELISA kit
E07P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Prefoldin subunit 3(VBP1) ELISA kit
E07P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Prefoldin subunit 3(VBP1) ELISA kit
E07P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Prefoldin subunit 3(VBP1) ELISA kit
E09P0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Prefoldin subunit 3(VBP1) ELISA kit
E09P0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Prefoldin subunit 3(VBP1) ELISA kit
E09P0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prefoldin subunit 3(VBP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Prefoldin subunit 3, Vbp1 ELISA KIT
ELI-15243m 96 Tests
EUR 865
Bovine Prefoldin subunit 3, VBP1 ELISA KIT
ELI-16032b 96 Tests
EUR 928
Human Prefoldin subunit 3, VBP1 ELISA KIT
ELI-43685h 96 Tests
EUR 824
Human Prefoldin Subunit 3 (VBP1) ELISA Kit
abx384221-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
VBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2606802 1.0 ug DNA
EUR 154
VBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2606803 1.0 ug DNA
EUR 154
VBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2606804 1.0 ug DNA
EUR 154
Vbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3409502 1.0 ug DNA
EUR 154
Vbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3409503 1.0 ug DNA
EUR 154
Vbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3409504 1.0 ug DNA
EUR 154
VBP1 Protein Vector (Mouse) (pPB-C-His)
PV244926 500 ng
EUR 603
VBP1 Protein Vector (Mouse) (pPB-N-His)
PV244927 500 ng
EUR 603
VBP1 Protein Vector (Mouse) (pPM-C-HA)
PV244928 500 ng
EUR 603
VBP1 Protein Vector (Mouse) (pPM-C-His)
PV244929 500 ng
EUR 603
VBP1 Protein Vector (Human) (pPB-C-His)
PV045701 500 ng
EUR 329
VBP1 Protein Vector (Human) (pPB-N-His)
PV045702 500 ng
EUR 329
VBP1 Protein Vector (Human) (pPM-C-HA)
PV045703 500 ng
EUR 329
VBP1 Protein Vector (Human) (pPM-C-His)
PV045704 500 ng
EUR 329
Recombinant Human VBP1 Protein, His, E.coli-1mg
QP13928-1mg 1mg
EUR 2757
Recombinant Human VBP1 Protein, His, E.coli-20ug
QP13928-20ug 20ug
EUR 201
Recombinant Human VBP1 Protein, His, E.coli-5ug
QP13928-5ug 5ug
EUR 155
Vbp1 3'UTR Luciferase Stable Cell Line
TU121741 1.0 ml Ask for price

Back to top