WAC

WAC siRNA
20-abx939625
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WAC siRNA
20-abx939626
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WAC Polyclonal Antibody
30135-100ul 100ul
EUR 252
WAC Polyclonal Antibody
30135-50ul 50ul
EUR 187
Polyclonal WAC Antibody
APR06814G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WAC . This antibody is tested and proven to work in the following applications:
WAC cloning plasmid
CSB-CL861133HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgtctttaacatctgatgcgtcatccccaagatcatatgtttctccaagaataagcacacctcaaactaacacagtccctatcaaacctttgatcagtactcctcctgtttcatcacagccaaaggttagtactccagtagttaagcaaggaccagtgtcacagtcagccacaca
  • Show more
Description: A cloning plasmid for the WAC gene.
WAC cloning plasmid
CSB-CL861133HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1950
  • Sequence: atggtaatgtatgcgaggaaacagcagagactcagtgatggctgtcacgaccggaggggggactcgcagccttaccaggcacttaagtattcatcgaagagtcaccccagtagcggtgatcacagacatgaaaagatgcgagacgccggagatccttcaccaccaaataaaatgt
  • Show more
Description: A cloning plasmid for the WAC gene.
WAC Rabbit pAb
A17703-100ul 100 ul
EUR 308
WAC Rabbit pAb
A17703-200ul 200 ul
EUR 459
WAC Rabbit pAb
A17703-20ul 20 ul
EUR 183
WAC Rabbit pAb
A17703-50ul 50 ul
EUR 223
Anti-WAC antibody
STJ119746 100 µl
EUR 277
Description: The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
WAC Antibody, HRP conjugated
1-CSB-PA861133HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
WAC Antibody, FITC conjugated
1-CSB-PA861133HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
WAC Antibody, Biotin conjugated
1-CSB-PA861133HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse Wac ELISA KIT
ELI-17505m 96 Tests
EUR 865
Human WAC ELISA KIT
ELI-28258h 96 Tests
EUR 824
WAC Polyclonal Conjugated Antibody
C30135 100ul
EUR 397
Human WAC shRNA Plasmid
20-abx959699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse WAC shRNA Plasmid
20-abx981384
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WAC Recombinant Protein (Human)
RP034486 100 ug Ask for price
WAC Recombinant Protein (Human)
RP034489 100 ug Ask for price
WAC Recombinant Protein (Mouse)
RP185087 100 ug Ask for price
WAC Recombinant Protein (Mouse)
RP185090 100 ug Ask for price
Enterobacteria phage T4 Fibritin (wac)
1-CSB-EP319157EDZ
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Enterobacteria phage T4 Fibritin(wac) expressed in E.coli
Wac ORF Vector (Mouse) (pORF)
ORF061697 1.0 ug DNA
EUR 506
Wac ORF Vector (Mouse) (pORF)
ORF061698 1.0 ug DNA
EUR 506
WAC ORF Vector (Human) (pORF)
ORF011496 1.0 ug DNA
EUR 95
WAC ORF Vector (Human) (pORF)
ORF011497 1.0 ug DNA
EUR 95
WAC sgRNA CRISPR Lentivector set (Human)
K2624401 3 x 1.0 ug
EUR 339
Wac sgRNA CRISPR Lentivector set (Mouse)
K4566401 3 x 1.0 ug
EUR 339
WAC sgRNA CRISPR Lentivector (Human) (Target 1)
K2624402 1.0 ug DNA
EUR 154
WAC sgRNA CRISPR Lentivector (Human) (Target 2)
K2624403 1.0 ug DNA
EUR 154
WAC sgRNA CRISPR Lentivector (Human) (Target 3)
K2624404 1.0 ug DNA
EUR 154
Wac sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4566402 1.0 ug DNA
EUR 154
Wac sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4566403 1.0 ug DNA
EUR 154
Wac sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4566404 1.0 ug DNA
EUR 154
WAC Protein Vector (Mouse) (pPB-C-His)
PV246786 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPB-N-His)
PV246787 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPM-C-HA)
PV246788 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPM-C-His)
PV246789 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPB-C-His)
PV246790 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPB-N-His)
PV246791 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPM-C-HA)
PV246792 500 ng
EUR 603
WAC Protein Vector (Mouse) (pPM-C-His)
PV246793 500 ng
EUR 603
WAC Protein Vector (Human) (pPB-C-His)
PV045981 500 ng
EUR 329
WAC Protein Vector (Human) (pPB-N-His)
PV045982 500 ng
EUR 329
WAC Protein Vector (Human) (pPM-C-HA)
PV045983 500 ng
EUR 329
WAC Protein Vector (Human) (pPM-C-His)
PV045984 500 ng
EUR 329
WAC Protein Vector (Human) (pPB-C-His)
PV045985 500 ng
EUR 329
WAC Protein Vector (Human) (pPB-N-His)
PV045986 500 ng
EUR 329
WAC Protein Vector (Human) (pPM-C-HA)
PV045987 500 ng
EUR 329
WAC Protein Vector (Human) (pPM-C-His)
PV045988 500 ng
EUR 329
Wac 3'UTR Luciferase Stable Cell Line
TU122179 1.0 ml Ask for price
WAC 3'UTR GFP Stable Cell Line
TU078352 1.0 ml
EUR 2333
Wac 3'UTR GFP Stable Cell Line
TU172179 1.0 ml Ask for price
WAC 3'UTR Luciferase Stable Cell Line
TU028352 1.0 ml
EUR 2333
WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716727 1.0 ug DNA
EUR 316
WAC Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV716731 1.0 ug DNA
EUR 316
WAC Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV716732 1.0 ug DNA
EUR 316
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody
abx034415-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody
abx034415-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody
20-abx313800
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WAC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2624405 3 x 1.0 ug
EUR 376
Wac sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4566405 3 x 1.0 ug
EUR 376
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (HRP)
20-abx313801
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (FITC)
20-abx313802
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (Biotin)
20-abx313803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV716728 1.0 ug DNA
EUR 316
WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV716729 1.0 ug DNA
EUR 374
WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV716730 1.0 ug DNA
EUR 374
WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2624406 1.0 ug DNA
EUR 167
WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2624407 1.0 ug DNA
EUR 167
WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2624408 1.0 ug DNA
EUR 167
Wac sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4566406 1.0 ug DNA
EUR 167

Back to top